View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6237_low_13 (Length: 298)
Name: NF6237_low_13
Description: NF6237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6237_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 5686622 - 5686342
Alignment:
| Q |
1 |
ttgtaggaaagtaatattgcatcagaatttagtaatcgtgcagaaagcgcagttgaattagctacgtaatcagattaaacaagtctgagctatgtgcagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5686622 |
ttgtaggaaagtaatattgcatcagaatttagtaatcgtgcagaaagcgcagttgaattagctacgtaatcagattaaacaagtctgagctatgtgcagt |
5686523 |
T |
 |
| Q |
101 |
tgctcataataaatggatcttgatgtgctaacattttaaaaataaataacactcttaacagaagatatgtatagcttgccttataagcaacaatatcttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5686522 |
tgctcataataaatggatcttgatgtgctaacattttaaaaataaataacactcttaacagaagatatgtatagcttgccttataagcaacaatatcttg |
5686423 |
T |
 |
| Q |
201 |
ccagtttagcttgttttcaaactcagcagatacataatccacatcttcaagttgtctgcgctccctaggctggcaatcctc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5686422 |
ccagtttagcttgttttcaaactcagcagatacataatccacatcttcaagttgtctgcgctccctaggctggcaatcctc |
5686342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 175 - 254
Target Start/End: Original strand, 39770411 - 39770490
Alignment:
| Q |
175 |
cttgccttataagcaacaatatcttgccagtttagcttgttttcaaactcagcagatacataatccacatcttcaagttg |
254 |
Q |
| |
|
||||||||||| ||||| |||||||||||| |||||||| |||||| ||||||||||||| ||| | ||||||||||| |
|
|
| T |
39770411 |
cttgccttataggcaaccatatcttgccagcttagcttgccttcaaattcagcagatacatgatctatgtcttcaagttg |
39770490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University