View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6237_low_14 (Length: 292)

Name: NF6237_low_14
Description: NF6237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6237_low_14
NF6237_low_14
[»] chr1 (1 HSPs)
chr1 (126-169)||(19506111-19506154)
[»] chr2 (1 HSPs)
chr2 (218-262)||(32963697-32963741)


Alignment Details
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 126 - 169
Target Start/End: Complemental strand, 19506154 - 19506111
Alignment:
126 gcaacttttttattttaaacgatcaaaattacgttccgatctag 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
19506154 gcaacttttttattttaaacgatcaaaattacgttccgatctag 19506111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 218 - 262
Target Start/End: Complemental strand, 32963741 - 32963697
Alignment:
218 aaaatgataatgttgttggtttaaaagatgcattacattttctta 262  Q
    ||||||| ||||| | ||||| |||||||||||||||||||||||    
32963741 aaaatgaaaatgtggatggttcaaaagatgcattacattttctta 32963697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University