View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6237_low_17 (Length: 264)
Name: NF6237_low_17
Description: NF6237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6237_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 217
Target Start/End: Original strand, 43142496 - 43142694
Alignment:
| Q |
19 |
atttcctcccatttctgcattcatgtttttaatcatttgctattaagctttgcaaccttaaactcattttaagtttggttttttataccccgttaccgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142496 |
atttcctcccatttctgcattcatgtttttaatcatttgctattaagctttgcaaccttaaactcattttaagtttggttttttataccccgttaccgtg |
43142595 |
T |
 |
| Q |
119 |
atggaaccagcaaaacttctgtgtcaaagtctgttcagttccttctgagccctttcatgaatttcttcctttctcaggttgtatattctaatcttgtcg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142596 |
atggaaccagcaaaacttctgtgtcaaagtctgttcagttccttctgagccctttcatgaatttcttcctttctcaggttgtatattctaatcttgtcg |
43142694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 135 - 213
Target Start/End: Original strand, 43154563 - 43154641
Alignment:
| Q |
135 |
ttctgtgtcaaagtctgttcagttccttctgagccctttcatgaatttcttcctttctcaggttgtatattctaatctt |
213 |
Q |
| |
|
||||||||||||| || | ||||||||||| ||||| ||||||||| |||||||| ||||||||| |||||||||| |
|
|
| T |
43154563 |
ttctgtgtcaaagcttgatttgttccttctgaccccttgcatgaatttattcctttcataggttgtatgttctaatctt |
43154641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 212 - 253
Target Start/End: Complemental strand, 2410821 - 2410780
Alignment:
| Q |
212 |
ttgtcgacctcaccaaacctgataaacgccgtcctgatgatg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2410821 |
ttgtcgacctcaccaaacctgataaacgccgtcctgatgatg |
2410780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University