View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6238_low_1 (Length: 424)
Name: NF6238_low_1
Description: NF6238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6238_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 88 - 183
Target Start/End: Original strand, 9418326 - 9418421
Alignment:
| Q |
88 |
ctatatcttgttttggtgctgaatattttgaaccggtctggtcaacacaactaacatgaagttgacatgttgttttcaactcttcaatctattttt |
183 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
9418326 |
ctatatcttgttttggttctgaatattttgaaccggtctggtcaacacaactaacatgaagttgagtttttgttttcaactcttcaatctattttt |
9418421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 90 - 182
Target Start/End: Complemental strand, 9423660 - 9423568
Alignment:
| Q |
90 |
atatcttgttttggtgctgaatattttgaaccggtctggtcaacacaactaacatgaagttgacatgttgttttcaactcttcaatctatttt |
182 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
9423660 |
atatcttgttttggttctgaatattttgaaccggtctggtcaacacaactaacatgaagttgagtttttgttttcaactcttcaatctatttt |
9423568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University