View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6238_low_5 (Length: 256)
Name: NF6238_low_5
Description: NF6238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6238_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 22940724 - 22940482
Alignment:
| Q |
1 |
tgtctcgactccccttgtttccgaaacaagtccagaaacggggcgccatggctttgttttgccaatcagcggtggctgtaggaaaaaagaaaggtggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22940724 |
tgtctcgactccccttgtttccgaaacaggtccagaaacggggcgccatggctttgttttgccaatcagcggtggctgtaggaaaaaagaaaggtggatt |
22940625 |
T |
|
| Q |
101 |
ttgagaaagtgagaaataaattgagnnnnnnnnnagtgaataaaatgttaataaagggtggattgaggatggaaggtggagaaagaaatagggcgaataa |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22940624 |
ttgagaaagtgagaaataaattgagtttttttttagtgaataaaatgttaataaagggtggattgaggatggaaggtggagaaagaaatagggcgaataa |
22940525 |
T |
|
| Q |
201 |
agtgggtgagagatggaggaatatgaatatttgatatttgcct |
243 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
22940524 |
agtgggtgagaggtggaggaatatgaatatttgatgtttgcct |
22940482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University