View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6238_low_7 (Length: 242)
Name: NF6238_low_7
Description: NF6238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6238_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 52446000 - 52446231
Alignment:
| Q |
1 |
aatgtatagttatgttgatgttcattattttattattggtgtttatttacatctttctattgtttcaatttatggatgattcacaatttcaatcgcaatg |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52446000 |
aatgtatagttgtgttgatgttcattattttattattggcgtttatttacatctttctattgtttcaatttatggatgattcacaatttcaatcacaatg |
52446099 |
T |
 |
| Q |
101 |
tacgtgtctctggttttgttctttttagattgtttcattttattattgatgattcatagtcgcagtgcatgtgtatgtgacgttgttttgttctttcgga |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52446100 |
tatgtgtctctggttttgttctttttagattgtttcattttatcattgatgattcatagtcgcagtgcatgtgtatgtgacgttgtttcgttctttcgga |
52446199 |
T |
 |
| Q |
201 |
ttcactctgtgtttgtgttgtattgctctgtg |
232 |
Q |
| |
|
|||||| |||||||||||||||||||| |||| |
|
|
| T |
52446200 |
ttcactttgtgtttgtgttgtattgctttgtg |
52446231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 52446940 - 52447167
Alignment:
| Q |
1 |
aatgtatagttatgttgatgttcattattttattattggtgtttatttacatctttctattgtttcaatttatggatgattcacaatttcaatcgcaatg |
100 |
Q |
| |
|
||||||| |||||||||||||||||| || ||||||||||||||||||||| ||| |||||||| |||||| |||||||| ||||||||||| | |||| |
|
|
| T |
52446940 |
aatgtatggttatgttgatgttcattgttctattattggtgtttatttacacgtttttattgttttaatttagggatgatt-acaatttcaatagtaatg |
52447038 |
T |
 |
| Q |
101 |
tacgtgtctctggttttgttctttttagattgtttcattttattattgatgattcatagtcgcagtgcatgtgtatgtgacgttgttttgttctttcgga |
200 |
Q |
| |
|
| |||| | |||||||||| | ||||||||||||||||||||||||||||||||| ||||| || |||||| ||| |||||||||||||||||| || |
|
|
| T |
52447039 |
gatgtgtatgtggttttgtt---tgtagattgtttcattttattattgatgattcataatcgcaatgtatgtgtttgttacgttgttttgttctttcaga |
52447135 |
T |
 |
| Q |
201 |
ttcactctgtgtttgtgttgtattgctctgtg |
232 |
Q |
| |
|
|||||| |||| ||||||||||||||| |||| |
|
|
| T |
52447136 |
ttcactttgtgcttgtgttgtattgctttgtg |
52447167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University