View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6239_high_12 (Length: 258)
Name: NF6239_high_12
Description: NF6239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6239_high_12 |
 |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0116 (2 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
| [»] scaffold0112 (1 HSPs) |
 |  |  |
|
| [»] scaffold0178 (1 HSPs) |
 |  |  |
|
| [»] scaffold0276 (1 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0062 (1 HSPs) |
 |  |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 148)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 194869 - 194628
Alignment:
| Q |
17 |
agtagcaaaactgtttaacatggtctaaacatctggattaaacaaatatgcatgcataagatatactctttcgagaatgaaatataaacaaaacaaaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194869 |
agtagcaaaactgtttaacatggtctaaacatctggattaaacaaatatgcatgcataagatatactctttcgagaatgaaatataaacaaaacaaaaaa |
194770 |
T |
 |
| Q |
117 |
gttattgaaaagtttatgtatatagattaaatttttggtagggatatttacatatt-----atatgcaggggctggggttcgaaccccggacattctact |
211 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||| || ||| |
|
|
| T |
194769 |
gttattgaaaagttgatgtatatagattaaatttttggtaaggatatttacatattatattatatgcaggggttggggttcgaaccccggacactccact |
194670 |
T |
 |
| Q |
212 |
tgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||| |||||||||||||||||||||||| || |||| ||||| |
|
|
| T |
194669 |
tgtccacaatttaattgtgtgagttctagccactatactact |
194628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 25235849 - 25235762
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| || |||| | |||||||||||||||||||||||| |
|
|
| T |
25235849 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagttcta |
25235762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 48569228 - 48569127
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
48569228 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggct |
48569130 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
48569129 |
act |
48569127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 3764060 - 3763973
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| || | || |||| | ||||||||||||||||||| |||| |
|
|
| T |
3764060 |
ttggtagggatatt-acatattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaattgtgtgagctcta |
3763973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 18360511 - 18360601
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||||||||||||||| || |||| | ||||||| ||||||||||||||||||| |
|
|
| T |
18360511 |
ttggtagggatatc-acattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagttctaacc |
18360601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 36602418 - 36602328
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||||||||||||||| || |||| | ||||||| ||||||||||||||||||| |
|
|
| T |
36602418 |
ttggtagggatatc-acattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagttctaacc |
36602328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 627034 - 626933
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||| | |||||||||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
627034 |
ttggtagggatattg-catattatatgcaagagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggct |
626936 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
626935 |
act |
626933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 6371132 - 6371233
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| ||||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
6371132 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttcttcacaattaaattgtgtgagctctagccactaggct |
6371230 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
6371231 |
act |
6371233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 153 - 239
Target Start/End: Original strand, 22819428 - 22819513
Alignment:
| Q |
153 |
ggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||| |||| || |||| ||||||||||||||||||||| |||| |
|
|
| T |
22819428 |
ggtagggatattg-catattatatgcaggagctggggttcgaaccccagacactccactttttcacaatttaattgtgtgagctcta |
22819513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 26919520 - 26919419
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| ||||||| || |||| ||||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
26919520 |
ttggtagggatattg-catattatatgcaggagctggggttcgaactccggacactccacttcttcacaattaaattgtgtgagctctagccactaggct |
26919422 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
26919421 |
act |
26919419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 45849065 - 45849166
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||| |||||||||| ||||| || |||| | |||||||||||||||||||||||| || ||| ||| |
|
|
| T |
45849065 |
ttggtagggatattg-catattttatgcaggggctggagttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggct |
45849163 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
45849164 |
act |
45849166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 47934109 - 47934037
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
47934109 |
catattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctcta |
47934037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 9761133 - 9761223
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| | |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
9761133 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctaacc |
9761223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 23778877 - 23778787
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||| |||| | |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
23778877 |
ttggtagggatatt-acatattatatgcaggggttggggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctaacc |
23778787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 1458055 - 1457969
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| ||| |||||| |
|
|
| T |
1458055 |
catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctact |
1457969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 3847699 - 3847800
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||| ||||||||| || |||| | ||||||| |||||||||||||||| || ||| ||| |
|
|
| T |
3847699 |
ttggtagggatattg-catattatatgcaggagccggggttcgatccccggacactccacttctccacaattaaattgtgtgagttctagccactaggct |
3847797 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
3847798 |
act |
3847800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 8965112 - 8965213
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | |||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
8965112 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctctacaattaaattgtgtgagctctaaccactaggct |
8965210 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
8965211 |
act |
8965213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 12582080 - 12581979
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
12582080 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
12581982 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
12581981 |
act |
12581979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 39023193 - 39023294
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||| ||||| || |||| | |||||||||||||||| ||||||| || ||| ||| |
|
|
| T |
39023193 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaaccctggacactccacttctccacaatttaattgtgtaagttctagccactaggct |
39023291 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
39023292 |
act |
39023294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 43147436 - 43147335
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
43147436 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
43147338 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
43147337 |
act |
43147335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 43596913 - 43597014
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
43596913 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
43597011 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
43597012 |
act |
43597014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 46775082 - 46774981
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
46775082 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
46774984 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
46774983 |
act |
46774981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 29771351 - 29771264
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||| || || |||| | |||||||||||||| |||| |||| |
|
|
| T |
29771351 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccgggcactccacttctccacaatttaattgtttgagctcta |
29771264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 55251403 - 55251316
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
55251403 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
55251316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 4590264 - 4590346
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| |||||||||||| |||| || |||| | ||||||||||||||||||| |
|
|
| T |
4590264 |
ttggtagggatattg-catattatatacaggggctgaggttcgaaccccagacactccacttctccacaatttaattgtgtgag |
4590346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 21935495 - 21935577
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
21935495 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgag |
21935577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 42218768 - 42218850
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||||||||| ||||||| || |||| | ||||||||||||||||||| |
|
|
| T |
42218768 |
ttggtagggatattg-catattatacgtaggggctggggttcgaactccggacactccacttctccacaatttaattgtgtgag |
42218850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 46105553 - 46105635
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
46105553 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgag |
46105635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 238
Target Start/End: Original strand, 46582652 - 46582738
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttct |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || | |||||||||||| |||| || |||| | ||||||||||||||||||||||| |
|
|
| T |
46582652 |
ttggtagggatattg-catattatatgcaggagccgaggttcgaaccccagacactccacttctccacaatttaattgtgtgagttct |
46582738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 2222557 - 2222658
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
2222557 |
ttggtagggatattg-catgttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
2222655 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
2222656 |
act |
2222658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 3036107 - 3036006
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
3036107 |
ttggtagggatattg-catattatatgcaggggccgaggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
3036009 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
3036008 |
act |
3036006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 241
Target Start/End: Complemental strand, 5179919 - 5179845
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||||| |
|
|
| T |
5179919 |
catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaac |
5179845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 30057240 - 30057341
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||| ||||||||||| | |||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
30057240 |
ttggtagggatattg-catattatatgcaggggtcggggttcaaaccccggacaccccacttctccacaattaaattgtgtgagctctaaccactaggct |
30057338 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
30057339 |
act |
30057341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 36132262 - 36132348
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| ||| |||||| |
|
|
| T |
36132262 |
catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgaggtctaaccactaggctact |
36132348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 37935879 - 37935980
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| || |||| |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
37935879 |
ttggtagggatattg-catattatatgcaggggctggggttcgaactccagacacaacacttctccacaatttaattgtgtgagctctagccactaggct |
37935977 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
37935978 |
act |
37935980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 47890728 - 47890814
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| || |||| | ||||||| ||||||||||| ||||||| ||| |||||| |
|
|
| T |
47890728 |
catattatatgcaggggtcggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctaaccactaggctact |
47890814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 49901500 - 49901601
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | ||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
49901500 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccgcttctccacaattaaattgtgtgagctctagccactaggct |
49901598 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
49901599 |
act |
49901601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 27434199 - 27434115
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| | ||||||||||||| || |||||||||||||| ||||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
27434199 |
gtagggatattga-atattatatgcagaggtcagggttcgaaccccgaacattctacttctccacaatttaattgtgtgagctcta |
27434115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 10417273 - 10417186
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | |||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
10417273 |
ttggtagggatatt-acatattatatgcaggagtcagggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
10417186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 13264326 - 13264239
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||| || | ||||||||||||||||||| | |||| ||||||||| ||||||||||| |||| |
|
|
| T |
13264326 |
ttggtagggatattg-catattatatgcaaggaccggggttcgaaccccggacaccccacttcttcacaattaaattgtgtgagctcta |
13264239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 31852650 - 31852578
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||| || | || | ||||||||||||||||||| |||| |
|
|
| T |
31852650 |
catattatatgtaggggttggggttcgaaccccggacactccatttctccacaatttaattgtgtgagctcta |
31852578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 42231545 - 42231617
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
42231545 |
catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
42231617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 45112163 - 45112076
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | || |||| ||||||||||| |||| |
|
|
| T |
45112163 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgtgtgagctcta |
45112076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 56088006 - 56087919
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||||||| |||||||| | |||| | ||||||| |||||||||||||||| |
|
|
| T |
56088006 |
ttggtagggatattg-cattttatatgcaggggccggggttcgaatcccggacaccccacttctccacaattaaattgtgtgagttcta |
56087919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 5165890 - 5165956
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||| || |||| | ||||||||||||||||||| |
|
|
| T |
5165890 |
catattatatgcaggggccggggttcgaacccc-gacactccacttctccacaatttaattgtgtgag |
5165956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 13578517 - 13578435
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
13578517 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaaccccggacaccccacttctccacaattaaattgtgtgag |
13578435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 22230486 - 22230404
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | |||||| ||||||||||| |
|
|
| T |
22230486 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctcaacaattaaattgtgtgag |
22230404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 45126150 - 45126232
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||| |||||||||||| |||| || |||| | ||||||||||||||||||| |
|
|
| T |
45126150 |
ttggtagggatattgt-atattatatgcaggagctgaggttcgaaccccagacactccacttctccacaatttaattgtgtgag |
45126232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 168 - 239
Target Start/End: Complemental strand, 46998404 - 46998333
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
46998404 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
46998333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 167 - 230
Target Start/End: Complemental strand, 50457751 - 50457688
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtg |
230 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| || |||| | ||||||||||||||| |
|
|
| T |
50457751 |
catattatatgcaggggccagggttcgaaccccggacactccacttctccacaatttaattgtg |
50457688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 154 - 253
Target Start/End: Complemental strand, 53634300 - 53634202
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| |||||||||| |||| |||||| ||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
53634300 |
gtagggatattg-catattatatacaggagctgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
53634202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 637132 - 637218
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||| | |||| || ||| |||||| |
|
|
| T |
637132 |
catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgtgctctagccactaggctact |
637218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 4700990 - 4700889
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || || |||||||||||||| | |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
4700990 |
ttggtagggatattgt-atattatatgcaggggtcggtgtccgaaccccggacatcccacttctccacaatttaattgtgtgagctctagccactaggct |
4700892 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
4700891 |
act |
4700889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 5305043 - 5304961
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
5305043 |
ttatatgcaggggccgaggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
5304961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 15604073 - 15603991
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| || |||| | |||||||||||| ||||||||||| || ||| |||||| |
|
|
| T |
15604073 |
ttatatgcaggggtcgggattcgaaccccggacactccacttctccacaatttaattatgtgagttctagccactaagctact |
15603991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 233
Target Start/End: Complemental strand, 23705205 - 23705124
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||||||||||| | |||| | ||||||| |||||||||| |
|
|
| T |
23705205 |
ttggtagggatattg-catattacatgcaggagctggggttcgaaccccggacacttcacttctccacaattaaattgtgtga |
23705124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 40994155 - 40994054
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| | ||||||||||| |||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
40994155 |
ttggtagggatattg-catattatatgtaggagttggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
40994057 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
40994056 |
act |
40994054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 48744226 - 48744326
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
||||||||||||| | ||||||||||||||| || || ||||||||| ||||| || |||| | |||||||||||||||||||||||| || ||| ||| |
|
|
| T |
48744226 |
ttggtagggatata-atatattatatgcagggactagg-ttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggct |
48744323 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
48744324 |
act |
48744326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 49757321 - 49757235
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
49757321 |
catattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
49757235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 52731476 - 52731390
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
52731476 |
catattatatgcaggagccggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagccactaggctact |
52731390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 55238551 - 55238450
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||| ||| | || ||| || |||| || ||||||||||||||| ||||||| || ||| ||| |
|
|
| T |
55238551 |
ttggtagggatattg-catattatatgcaggggccggggtttgaatctcgaacactccacttttttacaatttaattgtgtaagttctagccactaggct |
55238453 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
55238452 |
act |
55238450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 55853145 - 55853059
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||| | |||| ||||||||| |||||||||| |||| || ||| |||||| |
|
|
| T |
55853145 |
catattatatgcaggggccggtgttcgaaccccgaacatcccacttcttcacaattagattgtgtgagctctagccactaggctact |
55853059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 17617013 - 17616952
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtg |
232 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| || |||| | ||||||| ||||||||| |
|
|
| T |
17617013 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtg |
17616952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 231
Target Start/End: Original strand, 3815078 - 3815157
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||| | || |||| | ||||||| ||||||| |
|
|
| T |
3815078 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccggatactccacttctccacaattatattgtgt |
3815157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 4234322 - 4234250
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
4234322 |
catattatatgcaggagccggggttcgaacctcggacactccacttttccacaattaaattgtgtgagctcta |
4234250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 7686295 - 7686227
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
7686295 |
ttatatgcaggggccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctcta |
7686227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 48615524 - 48615437
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||| || ||||||||||||||||| | || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
48615524 |
ttggtagggatattg-catattatatgcagaagccggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctcta |
48615437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 48798297 - 48798383
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||||||||||||||||||| || | || | ||||||| ||||||||||| |||| |
|
|
| T |
48798297 |
ttggtagggatattg-cattttata-gcaggggctggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctcta |
48798383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 52798296 - 52798382
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||| | | ||||||||||||||| ||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
52798296 |
ttggtagggatattg-catattatatgcagagtc-ggggttcgaaccccgtacactccacttctccacaatttaattgtgtgagctcta |
52798382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 53376731 - 53376644
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||| ||||||||||||||||||| || |||| | ||||||| ||| ||||||| |||| |
|
|
| T |
53376731 |
ttggtagggatattg-catgttatatgcaagggccggggttcgaaccccggacactccacttctccacaattaaatcgtgtgagctcta |
53376644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 251
Target Start/End: Complemental strand, 53572364 - 53572280
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgcta |
251 |
Q |
| |
|
||||||||||||||| || ||| ||| ||||||||||| || |||| | ||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
53572364 |
catattatatgcaggagccgggattcaaaccccggacactccacttctccacaatttaattgtgtgagcgctaaccactaggcta |
53572280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 55021587 - 55021659
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
55021587 |
catattatatgcaggggtcggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctcta |
55021659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 4958608 - 4958526
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| |||| |||||| |
|
|
| T |
4958608 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattatgtgag |
4958526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 5801988 - 5802055
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||| || |||| | |||||||| |||||||||| |
|
|
| T |
5801988 |
catattatatgcaggggctggggttcgaacctcacacactccacttctccacaattttattgtgtgag |
5802055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 20320474 - 20320541
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
20320474 |
catattatatgcaggggccgaagttcgaaccccggacactccacttcaccacaatttaattgtgtgag |
20320541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 22788726 - 22788644
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | |||| ||| |||||||| | |||| | ||||||||||||||||||| |
|
|
| T |
22788726 |
ttggtagggatattg-catattatatgcaggggccgaggtttgaatcccggacaccccacttctccacaatttaattgtgtgag |
22788644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 24680138 - 24680056
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||| || |||| || |||| | ||||||||||||||||| |
|
|
| T |
24680138 |
ttggtagggatattg-catattatatgcaggggctgaggttcgaactccagacactccacttctctgcaatttaattgtgtgag |
24680056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 26868367 - 26868448
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||| ||||||||||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
26868367 |
ttggtagggatattg-catattatatgcaggagccggg-ttcgaaccccggacactccacttctccacaattaaattgtgtgag |
26868448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 242
Target Start/End: Complemental strand, 29329856 - 29329785
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||| || |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
29329856 |
ttatatgtaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctaacc |
29329785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 34618319 - 34618382
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
34618319 |
ttatatgcaggggttggggttggaaccccggacactccacttctccacaattaaattgtgtgag |
34618382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 242
Target Start/End: Original strand, 37310060 - 37310135
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||| |||| | |||| |||| |||| |||||||||| |||||||| |
|
|
| T |
37310060 |
catattatatgtaggggttggggttcaaaccccgtacatcccacttcttcataattaaattgtgtgaattctaacc |
37310135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 37868604 - 37868529
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||| |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
37868604 |
catattatatgcaggggctggagttcgaacctcggacacctcacttctccacaattaaattgtgtgagctctaacc |
37868529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 253
Target Start/End: Original strand, 40486481 - 40486559
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| ||||||||||||||||||| || |||| ||||| |||||| |||||||| |||| || ||| |||||| |
|
|
| T |
40486481 |
tatgcaggggccggggttcgaaccccggacactccacttcttcac-atttaaatgtgtgagctctagccactaggctact |
40486559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 42395245 - 42395327
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| ||||||||||| ||||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
42395245 |
ttggtagggatattg-catattatatgtaggggccggggttcgaactccggacaccccacttctccacaattaaattgtgtgag |
42395327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 43978026 - 43978115
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||| |||| ||| || |||| | |||||||||||||| |||| ||||||| |
|
|
| T |
43978026 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaa-cccgtacactccacttctccacaatttaattgtatgagctctaacc |
43978115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 253
Target Start/End: Original strand, 48950820 - 48950903
Alignment:
| Q |
170 |
attatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
48950820 |
attatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
48950903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 53815728 - 53815763
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
53815728 |
tattatatgcaggggctggggttcgaaccccggaca |
53815763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 54854241 - 54854206
Alignment:
| Q |
170 |
attatatgcaggggctggggttcgaaccccggacat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
54854241 |
attatatgcaggggctggggttcgaaccccggacat |
54854206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 17447222 - 17447140
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| | |||||||||||| | ||||| || | || ||||||||| |||||||||||||||| || ||| |||||| |
|
|
| T |
17447222 |
ttatatgcaggagttggggttcgaactctggacactccatttcttcacaattaaattgtgtgagttctagccactaggctact |
17447140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 40051640 - 40051741
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| |||||||||||||| |||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
40051640 |
ttggtagggatattg-catattatatgtaggggtaggggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
40051738 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
40051739 |
act |
40051741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 43207687 - 43207768
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||| |||| |||||| ||| | ||||||| |||||||||| |
|
|
| T |
43207687 |
ttggtagggatattg-catattatatgcaggagcttgggttcgaatcccgaacattccactactccacaattaaattgtgtga |
43207768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 49447154 - 49447240
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| ||| || ||||||||||||| ||||| || |||| | ||||||||||||||||| | |||| || ||| |||||| |
|
|
| T |
49447154 |
catattatatgtaggagccggggttcgaaccctggacactccacttctccacaatttaattgtgtgggctctagccactaggctact |
49447240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 56479278 - 56479179
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| | |||||||||||||||||| | |||| || ||| |||| |||| |||||||||||| ||| ||| |
|
|
| T |
56479278 |
ttggtagggatattg-catattatatgcagggg-tcgggttcgaaccccggacaccccacttctttaca-tttagttgtctgagttctaaccactaggct |
56479182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 8848264 - 8848212
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
8848264 |
ttggtagggatattg-catattatatacaggggccggggttcgaaccccggaca |
8848212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 11375926 - 11375889
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11375926 |
catattatatgcaggggccggggttcgaaccccggaca |
11375889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 174 - 239
Target Start/End: Original strand, 29356316 - 29356381
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||| |||| | ||||||||||||||||| || | || | |||||||||||||||||||||||| |
|
|
| T |
29356316 |
tatgcaagggcagaggttcgaaccccggacactccatttctccacaatttaattgtgtgagttcta |
29356381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 30305836 - 30305869
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30305836 |
ttatatgcaggggctggggttcgaaccccggaca |
30305869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 12504695 - 12504608
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | | ||||||||||||||| | || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
12504695 |
ttggtagggatattg-catattatatgcaggagtcgaggttcgaaccccggatactccacttctccacaattaaattgtgtgagctcta |
12504608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 19963800 - 19963887
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| |||||| | |||| | ||||||||||||||||| |||| |
|
|
| T |
19963800 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaacctcggacacttcacttctctgcaatttaattgtgtgagctcta |
19963887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 27362881 - 27362794
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||| | |||||||||||| || | |||| | ||||||| |||||||||||||||| |
|
|
| T |
27362881 |
ttggtagcgatatt-acatattatatgcaggggccgacgttcgaaccccgaactccccacttctccacaattaaattgtgtgagttcta |
27362794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 29505787 - 29505700
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||| |||||||||| ||| |||||||||| |||||||| || |||| | |||||| ||||||||||| |||| |
|
|
| T |
29505787 |
ttggtagggatatc-acattttatatgcagaggccggggttcgaatcccggacactccacttctcgacaattaaattgtgtgagctcta |
29505700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 36802175 - 36802243
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||| ||||| ||| |||||||| ||||||| || | || ||||||||| |||||||||||||||| |
|
|
| T |
36802175 |
ttatatgtaggggttggagttcgaactccggacactccattttttcacaattaaattgtgtgagttcta |
36802243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 39696389 - 39696303
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| | | |||||||||||||| ||| ||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
39696389 |
ttggtagggatattg-catattatatgtaggag-tcgggttcgaaccccgaacactctacttctccacaattaaattgtgtgagctcta |
39696303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 49056808 - 49056880
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| || || |||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
49056808 |
catattatatgcaggagccggagttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
49056880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 51512061 - 51511974
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||| | || ||||||||||||||||||| || |||| | ||||||| |||| |||||| |||| |
|
|
| T |
51512061 |
ttggtagggatattg-catattatatgctgtagccggggttcgaaccccggacactccacttctccacaattaaattatgtgagctcta |
51511974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 9692994 - 9693029
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9692994 |
tattatatgcaggggccggggttcgaaccccggaca |
9693029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 253
Target Start/End: Original strand, 10141035 - 10141102
Alignment:
| Q |
186 |
ggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
10141035 |
ggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
10141102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 242
Target Start/End: Original strand, 12267551 - 12267626
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||| ||||||| | |||| ||||||||||| | |||| | |||||| |||||||||||| ||||||| |
|
|
| T |
12267551 |
catattatatgtaggggctagagttcaaaccccggacaccccacttctccacaatataattgtgtgagctctaacc |
12267626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 14149825 - 14149860
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14149825 |
tattatatgcaggggccggggttcgaaccccggaca |
14149860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 242
Target Start/End: Original strand, 19594266 - 19594341
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||| |||||| |||||||||||| ||||||| | || | ||||||||| ||||||||| ||||||| |
|
|
| T |
19594266 |
catattatatgtaggggccagggttcgaaccctagacattccatttttccacaatttatttgtgtgagctctaacc |
19594341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 28520794 - 28520759
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28520794 |
tattatatgcaggggccggggttcgaaccccggaca |
28520759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 28540460 - 28540405
Alignment:
| Q |
186 |
ggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
||||||||||||||| ||| ||||||| | |||||||||||||||||| |||||| |
|
|
| T |
28540460 |
ggggttcgaaccccgaacactctacttctctacaatttaattgtgtgagctctaac |
28540405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 28715727 - 28715790
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| || |||| | |||| || || |||||||| |
|
|
| T |
28715727 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacatttaaaatgtgtgag |
28715790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 30217617 - 30217699
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| | ||||||| ||| |||| || | || | ||||||| ||||||||||| |
|
|
| T |
30217617 |
ttggtagggatattg-catattatatgcaggggctagagttcgaatcccagacactccagttctccacaattaaattgtgtgag |
30217699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 34773746 - 34773711
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34773746 |
tattatatgcaggggctgaggttcgaaccccggaca |
34773711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 47018009 - 47017974
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47018009 |
tattatatgcaggggccggggttcgaaccccggaca |
47017974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 48968273 - 48968238
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48968273 |
tattatatgcaggggccggggttcgaaccccggaca |
48968238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 53698043 - 53698008
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53698043 |
tattatatgcaggggccggggttcgaaccccggaca |
53698008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 164 - 239
Target Start/End: Original strand, 54029583 - 54029658
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||| | || ||||||| |||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
54029583 |
ttacatattatatgtagggaccggagttcgaatcccggacactccacttctccacaattaaattgtgtgagctcta |
54029658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 6170999 - 6170938
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagtt |
236 |
Q |
| |
|
|||| ||||||||||||||||||| | |||| ||||||| | ||| ||||||||||||||||| |
|
|
| T |
6170999 |
tatgtaggggctggggttcgaacctcagacactctacttctccac-atttaattgtgtgagtt |
6170938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 10402474 - 10402560
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
10402474 |
catattatatgcaggggtcggagttcgaaccccggacacctcacttctccacaattaaattgtgtgagctctagccactaggctact |
10402560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 33530811 - 33530912
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| ||||||||||||||||| | || |||| | || |||| ||||||||||| |||| || ||| ||| |
|
|
| T |
33530811 |
ttggtagggatattg-catattatatgtagggatcggggttcgaaccccggatactccacttctccataattgaattgtgtgagctctagccactaggct |
33530909 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
33530910 |
act |
33530912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 241
Target Start/End: Complemental strand, 34019480 - 34019410
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
|||||||||| ||||| |||||||| |||||||| || |||| | ||||||||||||| |||| |||||| |
|
|
| T |
34019480 |
ttatatgcagaggctgaggttcgaaacccggacactccacttctctacaatttaattgtatgagctctaac |
34019410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 34353797 - 34353898
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||| || |||||||||||||||||| | |||| | ||||||| |||| |||||| | ||||| ||| ||| |
|
|
| T |
34353797 |
ttggtagggatattg-catattatatgcagaggtcagggttcgaaccccggacaccccacttctccacaattaaattatgtgagctgtaaccactaggct |
34353895 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
34353896 |
act |
34353898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 35948215 - 35948134
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| || ||||||||||||||||||| || || | | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
35948215 |
ttatatgcaggagccggggttcgaaccccggacactccac-tctccacaattaaattgtgtgagctctagccactaggctact |
35948134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 37251131 - 37251212
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| |||||| |||||||| || ||||||||||| |||||| || |||| | ||||||| |||||||||| |
|
|
| T |
37251131 |
ttggtagggatattg-catattttatgcaggagccggggttcgaacatcggacactccacttctccacaattaaattgtgtga |
37251212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 43481072 - 43481011
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| || |||| | ||||||| |||||||||| |
|
|
| T |
43481072 |
ttatatgcaggggccggggttcgaa-cccggacactccacttctccacaattaaattgtgtga |
43481011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 55055949 - 55056034
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||| ||||||||||| | ||||||||||||||||| | |||| | ||| ||||||||||||||| || |||| ||| |||||| |
|
|
| T |
55055949 |
catattttatgcaggggccgaggttcgaaccccggacacgccacttctccac-atttaattgtgtgagctccaaccactacgctact |
55056034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 55531291 - 55531353
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| || |||| | |||||| |||||||||| |
|
|
| T |
55531291 |
ttatatgcaggggccggggttcaaaccccggacactccacttctcgacaattaaattgtgtga |
55531353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 2565100 - 2565148
Alignment:
| Q |
155 |
tagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| |||||| |||||||| |
|
|
| T |
2565100 |
tagggatatt-acatattatatgcaggggttgggattcgaatcccggaca |
2565148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 2688114 - 2688166
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| |||||||| |||||||| |
|
|
| T |
2688114 |
ttggtagggatattg-catattatatgcaggagctgtggttcgaatcccggaca |
2688166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 218
Target Start/End: Original strand, 9924888 - 9924937
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| || |||| ||||| |
|
|
| T |
9924888 |
tattatatgcaggggtcggggttcgaaccccggacactccacttattcac |
9924937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 240
Target Start/End: Original strand, 12763789 - 12763862
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaa |
240 |
Q |
| |
|
|||||||||| |||||| || ||||| | ||||||||| || |||| |||| |||| ||||||||||| ||||| |
|
|
| T |
12763789 |
catattatatacaggggttgaggttcaagccccggacactccacttcttcataattaaattgtgtgagctctaa |
12763862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 170 - 239
Target Start/End: Complemental strand, 17709494 - 17709425
Alignment:
| Q |
170 |
attatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||| |||||| || |||||||||||||||| || |||| | |||||| ||||||||||| |||| |
|
|
| T |
17709494 |
attatatgtaggggccggagttcgaaccccggacactccacttctctacaattaaattgtgtgagctcta |
17709425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 17815477 - 17815425
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
17815477 |
ttggtagggatatt-acatattatatgcaggggtcggggttcgaatccctgaca |
17815425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 187 - 236
Target Start/End: Original strand, 27627236 - 27627285
Alignment:
| Q |
187 |
gggttcgaaccccggacattctacttgttcacaatttaattgtgtgagtt |
236 |
Q |
| |
|
|||||||||||| ||||| ||||||| | ||||||| ||||||||||||| |
|
|
| T |
27627236 |
gggttcgaaccctggacactctacttctccacaattaaattgtgtgagtt |
27627285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 218
Target Start/End: Original strand, 33076562 - 33076611
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||| ||||| |
|
|
| T |
33076562 |
tattatatgcaggggtcggggttcgaaccccggacaccctacttattcac |
33076611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 36099216 - 36099183
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
36099216 |
ttatatgcaggggccggggttcgaaccccggaca |
36099183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 38690696 - 38690733
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38690696 |
catattatatgcaggggtcggggttcgaaccccggaca |
38690733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 49039506 - 49039473
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
49039506 |
ttatatgcagggactggggttcgaaccccggaca |
49039473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 174 - 239
Target Start/End: Original strand, 51890837 - 51890901
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | |||| | ||| ||||||||||||||| |||| |
|
|
| T |
51890837 |
tatgcaggggccggggttcgaaccccggacaccccacttctccac-atttaattgtgtgagctcta |
51890901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 198
Target Start/End: Complemental strand, 8144640 - 8144597
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccc |
198 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
8144640 |
gtagggatattg-catattatatgtaggggctggggttcgaaccc |
8144597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 27862887 - 27862859
Alignment:
| Q |
176 |
tgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27862887 |
tgcaggggctggggttcgaaccccggaca |
27862859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 205
Target Start/End: Original strand, 27921928 - 27921964
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacat |
205 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
27921928 |
tattatatgcaggggccggggttcgaaccccagacat |
27921964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 31308196 - 31308128
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| | | |||||||||||||| |||||| |||| ||||||| |||||| ||||||||| |
|
|
| T |
31308196 |
ttatatgcaggagttagggttcgaaccccgaacattccacttcaccacaattaaattgtatgagttcta |
31308128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 37889670 - 37889634
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37889670 |
atattatatgcaggggtcggggttcgaaccccggaca |
37889634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 199
Target Start/End: Original strand, 44602503 - 44602550
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaacccc |
199 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
44602503 |
ttggtagggatattg-cattttatatgcaggggccggggttcgaacccc |
44602550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 239
Target Start/End: Original strand, 48949682 - 48949734
Alignment:
| Q |
187 |
gggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||| |||||||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
48949682 |
gggttcgaatcccggacactccacttctccacaatttaattgtgtgagctcta |
48949734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 67; Significance: 7e-30; HSPs: 92)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 6210072 - 6210173
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| || |||| | ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6210072 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagttctaaccactatgct |
6210170 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
6210171 |
act |
6210173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 9435644 - 9435731
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
9435644 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctcta |
9435731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 30343 - 30257
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| || |||| |||||||||||||||||||||||||| || ||| |||||| |
|
|
| T |
30343 |
catattatatgcaggggccggggttcgaaccctggacactccacttcttcacaatttaattgtgtgagttctagccactaggctact |
30257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 15963995 - 15963894
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||| ||||| || |||| | |||||||||||||||||||||||| || ||| ||| |
|
|
| T |
15963995 |
ttggtagggatattg-catattttatgcaggggctggggttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggct |
15963897 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
15963896 |
act |
15963894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 3795826 - 3795725
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| | |||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
3795826 |
ttggtagggatattg-catattatatgcaggggctggggttcgaacctcagacactccacttctccacaatttaattgtgtgagctctagccactaggct |
3795728 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
3795727 |
act |
3795725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 7865407 - 7865306
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||| |||||| ||||| || |||| | |||||||||||||||||||||||| || ||| ||| |
|
|
| T |
7865407 |
ttggtagggatattg-catattatatgcaggggccggggtttgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaagct |
7865309 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
7865308 |
act |
7865306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 10934617 - 10934718
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| |||||||||||||||| || ||| ||| |
|
|
| T |
10934617 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagttctagccactaggct |
10934715 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
10934716 |
act |
10934718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 2426082 - 2426169
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||| ||||| |||||||||||||| ||| |||||||||||||||||||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
2426082 |
ttggtaggaatatt-acatattatatgcaagggttggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctcta |
2426169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 3294782 - 3294869
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||| | |||| ||||||||| |||||||||||||||| |
|
|
| T |
3294782 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaaccccggacaccccacttcttcacaattaaattgtgtgagttcta |
3294869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 9372253 - 9372166
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||| ||||| || |||| | |||||||||||||||||||||||| |
|
|
| T |
9372253 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaaccctggacactccacttctccacaatttaattgtgtgagttcta |
9372166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 153 - 239
Target Start/End: Original strand, 1435829 - 1435913
Alignment:
| Q |
153 |
ggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |||| | ||| ||||||||||||||| |||| |
|
|
| T |
1435829 |
ggtagggatatt-acatattatatgcaggggccagggttcgaaccccggacattccacttctccac-atttaattgtgtgagctcta |
1435913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 17441891 - 17441790
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
17441891 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
17441793 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
17441792 |
act |
17441790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 19953880 - 19953779
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
19953880 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
19953782 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
19953781 |
act |
19953779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 32611606 - 32611505
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
32611606 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
32611508 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
32611507 |
act |
32611505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 31802071 - 31802158
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
31802071 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
31802158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 32166387 - 32166474
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||| || |||||||||||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
32166387 |
ttggtagggatattg-catattatatgcaggggccgggatttgaaccccggacactccacttctccacaatttaattgtgtgagctcta |
32166474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 7153806 - 7153888
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | |||||||| |||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
7153806 |
ttggtagggatattg-catgttatatgcaggggccgaggttcgaatcccggacactccacttcttcacaatttaattgtgtgag |
7153888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 32813687 - 32813620
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| | || |||| ||||||||| ||||||||||| |
|
|
| T |
32813687 |
catattatatgcaggggccggggttcgaaccccggatactccacttcttcacaattaaattgtgtgag |
32813620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 216224 - 216325
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| |||||||||||||| |||||| | |||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
216224 |
ttggtagggatattg-catgttatatgcagggtctggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctaaccactaggct |
216322 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
216323 |
act |
216325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 4661114 - 4661215
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||| |||||||||| ||||||| |||| | || |||||| ||||||||| |||| || ||| ||| |
|
|
| T |
4661114 |
ttggtagggatattg-catattatatgcaggggttgggtttcgaaccccagacattccacttctccaaaatttatttgtgtgagctctagccactaggct |
4661212 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
4661213 |
act |
4661215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 7207862 - 7207963
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || | || | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
7207862 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggct |
7207960 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
7207961 |
act |
7207963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 19892328 - 19892227
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| ||||||||||||||||||| || |||| | ||||||||||||||| ||| |||| || ||| ||| |
|
|
| T |
19892328 |
ttggtagggatattg-catattatatgtaggggtcggggttcgaaccccggacactccacttctccacaatttaattgtgagagctctagccactaggct |
19892230 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
19892229 |
act |
19892227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 28148785 - 28148684
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||| ||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
28148785 |
ttggtagggatattg-catattatatgcaggagccgggtttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
28148687 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
28148686 |
act |
28148684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 233
Target Start/End: Complemental strand, 30885622 - 30885541
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||| |||| || | || | |||||||||||||||||| |
|
|
| T |
30885622 |
ttggtagggatattg-catattatatacaggggctggggttcgaaccccagacactccatttctccacaatttaattgtgtga |
30885541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 33573835 - 33573936
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||| ||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
33573835 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
33573933 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
33573934 |
act |
33573936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 34432849 - 34432748
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||| || ||||||||||||||| |||| || |||| | |||||||||||| ||||| ||||||| ||| ||| |
|
|
| T |
34432849 |
ttggtagggatattg-catattatatgcagaggttggggttcgaaccccagacactccacttctccacaatttaattatgtgaactctaaccactaggct |
34432751 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
34432750 |
act |
34432748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 1969014 - 1969066
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1969014 |
ttggtagggatatt-acatattatatgcaggggccggggttcgaaccccggaca |
1969066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 3640532 - 3640619
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||| |||||||||||| |||||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
3640532 |
ttggtagggatattg-catagtatatgcaagggccggggttcgaacctcggacactccacttctccacaatttaattgtgtgagctcta |
3640619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 227
Target Start/End: Original strand, 7072096 - 7072171
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaatt |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | ||||||||||||||||||| ||||||| | || ||||||||| |
|
|
| T |
7072096 |
ttggtagggatatt-acatattatatgcaggagtcggggttcgaaccccggacactctacttctccataatttaatt |
7072171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 13158761 - 13158674
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||| | ||||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
13158761 |
ttggtagggatattg-catattatatgcagagactggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
13158674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 13163617 - 13163530
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||| | ||||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
13163617 |
ttggtagggatattg-catattatatgcagagactggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
13163530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 14709057 - 14708985
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| |||||| ||||||||||| ||||||| || |||| | | |||||||||||||||||||||| |
|
|
| T |
14709057 |
catattatatgtaggggccggggttcgaactccggacactccacttctcctcaatttaattgtgtgagttcta |
14708985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 22997354 - 22997441
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||| ||||||||||||||||||| |||||| | ||||||| ||||||||||| |||| |
|
|
| T |
22997354 |
ttggtagggatattga-atattatatgtaggggtcggggttcgaaccccggacaccctacttctccacaattaaattgtgtgagctcta |
22997441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 23791047 - 23790960
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||| ||||||||||||||||||| |||||| | ||||||| ||||||||||| |||| |
|
|
| T |
23791047 |
ttggtagggatattga-atattatatgtaggggtcggggttcgaaccccggacaccctacttctccacaattaaattgtgtgagctcta |
23790960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 231
Target Start/End: Original strand, 31935117 - 31935196
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| ||||||||||||||||||| || |||| | |||||||||||||||| |
|
|
| T |
31935117 |
ttggtagggatattg-cattttatatgcaggggtcggggttcgaaccccggacactccacttctccacaatttaattgtgt |
31935196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 171 - 242
Target Start/End: Original strand, 8297664 - 8297735
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
8297664 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctaacc |
8297735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 8439693 - 8439783
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||| |||||| || ||||| || |||| | ||||||||||||||||||| ||||||| |
|
|
| T |
8439693 |
ttggtagggatattg-catattatatgcaggggtcgggattcgaatcctggacactcaacttctccacaatttaattgtgtgagctctaacc |
8439783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 152 - 239
Target Start/End: Original strand, 10913427 - 10913514
Alignment:
| Q |
152 |
tggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||| ||||||| |||||||||| |||||| ||||||||||||||||| | ||||||| | |||||| ||||||||||| |||| |
|
|
| T |
10913427 |
tggtagagatatttgcatattatatacaggggtcggggttcgaaccccggatactctacttctctacaattaaattgtgtgagctcta |
10913514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 171 - 242
Target Start/End: Original strand, 22574907 - 22574978
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| || |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
22574907 |
ttatatgcaggggttggggttcgaaccccgcacactccacttctccacaattaaattgtgtgagctctaacc |
22574978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 3794225 - 3794124
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||| ||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
3794225 |
ttggtagggatattg-catattatatgcaggaggcggggttcgaaccccgcacactccacttctccacaattaaattgtgtgagctctagccactaggct |
3794127 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
3794126 |
act |
3794124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 9246434 - 9246333
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||| ||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
9246434 |
ttggtagggatattg-catattatatgcaggaggcggggttcgaaccccgcacactccacttctccacaattaaattgtgtgagatctagccactaggct |
9246336 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
9246335 |
act |
9246333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 253
Target Start/End: Original strand, 10517236 - 10517318
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
10517236 |
ttatatgcaggggtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
10517318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 10913116 - 10913030
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| || |||| | || |||||||||||||||| |||| || ||| |||||| |
|
|
| T |
10913116 |
catattatatgcaggggtcggggttcgaaccccagacactccacttctccataatttaattgtgtgagctctagccactaagctact |
10913030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 28222881 - 28222981
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| |||||||||| |||||||| || |||| | || |||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
28222881 |
ttggtagggatattg-catattatatgcagaggccggggttcgaa-cccggacactccacttctccataattaaattgtgtgagctctaaccactaggct |
28222978 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
28222979 |
act |
28222981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 29284284 - 29284385
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| || |||||||||||||||| | |||| | ||||||| |||||||| ||||||| || ||| ||| |
|
|
| T |
29284284 |
ttggtagggatattg-catattatatgaaggggccggagttcgaaccccggacaccccacttctccacaattaaattgtgtaagttctagccactaggct |
29284382 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
29284383 |
act |
29284385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 150 - 239
Target Start/End: Original strand, 7418295 - 7418383
Alignment:
| Q |
150 |
tttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| | |||||||||| ||||| || |||| | || |||||||||||||||| |||| |
|
|
| T |
7418295 |
tttggtagggatattg-catattatatgcaggggcctgagttcgaaccctggacactccacttctccataatttaattgtgtgagctcta |
7418383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 232
Target Start/End: Original strand, 28030882 - 28030962
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtg |
232 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||| ||||| || |||| | |||| |||||||||||| |
|
|
| T |
28030882 |
ttggtagggatattg-catattatatgcaggggccagggttcgaaccctggacactccacttctccacagtttaattgtgtg |
28030962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 743581 - 743668
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||| ||| |||| |
|
|
| T |
743581 |
ttggtagggatattg-catattagatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgcgagctcta |
743668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 7545347 - 7545434
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||| ||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
7545347 |
ttggtagggatattg-catattatatgcaggggccagggttcgaaccccgaacaccccacttctccacaattaaattgtgtgagctcta |
7545434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 199
Target Start/End: Original strand, 8857108 - 8857155
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaacccc |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
8857108 |
ttggtagggatatt-acatattatatgcaggggccggggttcgaacccc |
8857155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 10483588 - 10483501
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| ||||||||||||||||||| || |||| | ||||||| |||||| |||| |||| |
|
|
| T |
10483588 |
ttggtagggatattg-cattttatatgcaggggtcggggttcgaaccccggacactccacttctccacaattaaattgtatgagctcta |
10483501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 11301400 - 11301472
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| | ||||||||||| | |||||| || |||| ||||||||| ||||||||||| |||| |
|
|
| T |
11301400 |
catattatatgcaggagttggggttcgaatctcggacactccacttcttcacaattaaattgtgtgagctcta |
11301472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 30704978 - 30705065
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||||| |||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
30704978 |
ttggtagggatattg-catgttatatgtaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
30705065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 30916339 - 30916426
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| |||||||| |||| |||||||||||||| ||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
30916339 |
ttggtagggatattg-catgttatatgcgggggttggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctcta |
30916426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 32412365 - 32412282
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcagggg-ctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||| ||||||| |||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
32412365 |
ttggtagggatattg-catattatatgcagggggctggagttcgaatcccggacactccacttctccacaattaaattgtgtgag |
32412282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 492935 - 493002
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
492935 |
catattatatgcaggggccggggttcgaaccctggacaccccacttctccacaattaaattgtgtgag |
493002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 3196637 - 3196726
Alignment:
| Q |
151 |
ttggtagggatatttacatattatat--gcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| | |||||||||||||||||| | || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
3196637 |
ttggtagggatatt-acatattatatatgcaggagttggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctcta |
3196726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 253
Target Start/End: Complemental strand, 13116662 - 13116575
Alignment:
| Q |
166 |
acatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| | ||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
13116662 |
acatattatatgcaagggccggggttcgaaccccggacacccctcttctccacaattaaattgtgtgagctctagccactaggctact |
13116575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 152 - 239
Target Start/End: Complemental strand, 32050016 - 32049930
Alignment:
| Q |
152 |
tggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||| || ||||||||||| ||| ||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
32050016 |
tggtagggatattg-catattatatgcaggagccggggttcgaactccgaacactccacttctccacaattaaattgtgtgagctcta |
32049930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 2816908 - 2817009
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||| | ||||||| ||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
2816908 |
ttggtagggatattg-catgttatatgcaggggctgagattcgaactccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
2817006 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
2817007 |
act |
2817009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 4408376 - 4408421
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaacc |
197 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4408376 |
ttggtagggatattg-catattatatgcaggggctggggttcgaacc |
4408421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 13732830 - 13732930
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||| || | || |||| ||||||||||| ||||||| | ||||||| |||||| |||| ||||||| ||| ||| |
|
|
| T |
13732830 |
ttggtagggatattg-catattatatgcaaggcc-ggagttcaaaccccggacactctacttctccacaattaaattgtatgagctctaaccactaggct |
13732927 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
13732928 |
act |
13732930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 27218917 - 27219003
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| ||| || ||| ||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
27218917 |
catattatatgtaggagccgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
27219003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 171 - 253
Target Start/End: Original strand, 28842692 - 28842773
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
28842692 |
ttatatgcaggggctggggttggaaccccagacactccactt-tccacaattaaattgtgtgagctctagccactaggctact |
28842773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 2251856 - 2251908
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
2251856 |
ttggtagggatattg-catactatatgcaggggccggggttcgaaccccggaca |
2251908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 152 - 253
Target Start/End: Original strand, 7581063 - 7581163
Alignment:
| Q |
152 |
tggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgcta |
251 |
Q |
| |
|
||||||||||||| ||| ||||||||||||| |||||||||||| || |||| ||||| | ||||||| ||||||||||| |||| || ||| |||| |
|
|
| T |
7581063 |
tggtagggatattg-cattttatatgcaggggttggggttcgaacgccagacaccttacttctccacaattaaattgtgtgagctctagccactaggcta |
7581161 |
T |
 |
| Q |
252 |
ct |
253 |
Q |
| |
|
|| |
|
|
| T |
7581162 |
ct |
7581163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 15091466 - 15091518
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
15091466 |
ttggtagggatattg-catattatatgcaggggccggggttcgaatcccggaca |
15091518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 172 - 253
Target Start/End: Complemental strand, 19618758 - 19618677
Alignment:
| Q |
172 |
tatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| | |||| | ||||||| |||||| |||| || |||| ||| |||||| |
|
|
| T |
19618758 |
tatatacaggggctggggttcgaaccccggacaccccacttctccacaattaaattgtatgagctcgaaccactaggctact |
19618677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 174 - 239
Target Start/End: Original strand, 24319053 - 24319117
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||||||||||||||| || |||| | ||||| ||||||||||||| |||| |
|
|
| T |
24319053 |
tatgcaggggccggggttcgaaccccggacactccacttctccacaa-ttaattgtgtgagctcta |
24319117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 253
Target Start/End: Complemental strand, 978183 - 978087
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||| ||||||| | |||| | ||||||| ||| |||||||||||||| ||| |||||| |
|
|
| T |
978183 |
gtagggatattg-catattatatgcaggggtcggggttcgaacaccggacaccccacttctccacaattaaat--tgtgagttctaaccactaagctact |
978087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 3012756 - 3012688
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| |||||| || |||||||| || | || | ||||||||||||||||||| |||| |
|
|
| T |
3012756 |
ttatatgcaggggctagggttcaaatcccggacactccatttctccacaatttaattgtgtgagctcta |
3012688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 12284139 - 12284226
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| | |||||||||||||| | ||||||||||| ||||| | || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
12284139 |
ttggtagggatattga-atattatatgcaggtgtcggggttcgaactccggaaactccacttctccacaattaaattgtgtgagctcta |
12284226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 171 - 242
Target Start/End: Original strand, 389370 - 389441
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||| || |||||||||||||||| || |||| | ||||||| |||||| |||| ||||||| |
|
|
| T |
389370 |
ttatatgcaggggtcggagttcgaaccccggacactccacttatccacaattaaattgtatgagctctaacc |
389441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 9438334 - 9438369
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9438334 |
tattatatgcaggggttggggttcgaaccccggaca |
9438369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 230
Target Start/End: Complemental strand, 19374877 - 19374815
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtg |
230 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||| || |||| | || |||||||||||| |
|
|
| T |
19374877 |
catattatatgcaggggttggggttcgaaccccgaacactccacttctcca-aatttaattgtg |
19374815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 22983612 - 22983647
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22983612 |
tattatatgcaggggccggggttcgaaccccggaca |
22983647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 23804796 - 23804761
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23804796 |
tattatatgcaggggccggggttcgaaccccggaca |
23804761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 33646852 - 33646954
Alignment:
| Q |
151 |
ttggtagggatatttacatatt-atatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgc |
249 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||| |||||||||||| |||||| | |||| | ||||||| ||||||||||| |||| || ||| || |
|
|
| T |
33646852 |
ttggtagggatattg-catatttatatgcaggggtcggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactaggc |
33646950 |
T |
 |
| Q |
250 |
tact |
253 |
Q |
| |
|
|||| |
|
|
| T |
33646951 |
tact |
33646954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 253
Target Start/End: Original strand, 7177332 - 7177414
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| | |||| | ||||||| || ||||||| |||| || ||| |||||| |
|
|
| T |
7177332 |
ttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaacagtgtgagctctagccactaggctact |
7177414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 9888577 - 9888476
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||| |||||||| | |||||| |||||||||||| || |||| | ||||||| |||| |||||| ||||||| ||| ||| |
|
|
| T |
9888577 |
ttggtagggatattgt-atattctatgcaggagtcggggtttgaaccccggacactccacttctccacaattaaattatgtgagctctaaccactaggct |
9888479 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
9888478 |
act |
9888476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 20728984 - 20729070
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| | |||| |||||||||| | ||||| || |||| |||||||||||||||||||| |||| || ||| |||||| |
|
|
| T |
20728984 |
catattatatgtaagggccggggttcgaattctggacactccacttcctcacaatttaattgtgtgagctctagccactaggctact |
20729070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 894684 - 894632
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
894684 |
ttggtagggatattg-catattatatgcaggggtcgaggttcgaaccccggaca |
894632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 6658608 - 6658571
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
6658608 |
cataatatatgcaggggccggggttcgaaccccggaca |
6658571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 7897171 - 7897118
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||| | |||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
7897171 |
ttggtagggataaatgcataatatatgcaggggtcggggttcgaaccccggaca |
7897118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 10455776 - 10455809
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
10455776 |
ttatatgcaggggccggggttcgaaccccggaca |
10455809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 196
Target Start/End: Original strand, 10628632 - 10628676
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaac |
196 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
10628632 |
ttggtagggatattg-catattatatgcaggggctggtgttcgaac |
10628676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 218
Target Start/End: Original strand, 12101918 - 12101967
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| |||||| ||||| |
|
|
| T |
12101918 |
tattatatgcaggggccggcgttcgaaccccggacaccctacttattcac |
12101967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 16913937 - 16913900
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16913937 |
catattatatgcaggggtcggggttcgaaccccggaca |
16913900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 27667197 - 27667230
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
27667197 |
ttatatgcaggggccggggttcgaaccccggaca |
27667230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 31104904 - 31104952
Alignment:
| Q |
155 |
tagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||| ||||||||||||||||||| || ||||||| |||||||| |
|
|
| T |
31104904 |
tagggatatt-acatattatatgcaggggccggagttcgaatcccggaca |
31104952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 32616421 - 32616454
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
32616421 |
ttatatgcaggggctggggttcgaatcccggaca |
32616454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 202
Target Start/End: Original strand, 29169683 - 29169715
Alignment:
| Q |
170 |
attatatgcaggggctggggttcgaaccccgga |
202 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
29169683 |
attatatgcagggactggggttcgaaccccgga |
29169715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 146)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 23178943 - 23178842
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| || |||| ||||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
23178943 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacactccacttcttcacaatttaattgtgtgagctctagccactaggct |
23178845 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
23178844 |
act |
23178842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 11875904 - 11876005
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
11875904 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggct |
11876002 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
11876003 |
act |
11876005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 11890911 - 11891012
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
11890911 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggct |
11891009 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
11891010 |
act |
11891012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 168 - 239
Target Start/End: Original strand, 42035370 - 42035441
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||| | ||||||||||||||||||| |||| |
|
|
| T |
42035370 |
atattatatgcaggggctggggttcgaaccccagacactctacttctccacaatttaattgtgtgagctcta |
42035441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 16449143 - 16449244
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||| |||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
16449143 |
ttggtagggatattg-catattatatgcaggggttggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggct |
16449241 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
16449242 |
act |
16449244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 34413080 - 34413181
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
34413080 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggct |
34413178 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
34413179 |
act |
34413181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 38955246 - 38955145
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||| || |||| | |||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
38955246 |
ttggtagggatatt-acatattatatgcaggggccggggttcgaaccccggacactcgacttctctacaattaaattgtgtgagctctatccactaggct |
38955148 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
38955147 |
act |
38955145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 1632492 - 1632402
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||| ||||| |||||||||||||||| | ||||||||||||||||||| ||||||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
1632492 |
ttggtaggaatatt-acatattatatgcaggagtcggggttcgaaccccggacactctacttctccacaattaaattgtgtgagctctaacc |
1632402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 2792812 - 2792879
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| || |||| | ||||||||||||||||||| |
|
|
| T |
2792812 |
catattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgag |
2792879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 29716878 - 29716968
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
29716878 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaacc |
29716968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 43856434 - 43856344
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| ||||||||||||||||||| || |||| | ||||||||||||||| ||| ||||||| |
|
|
| T |
43856434 |
ttggtagggatattg-cattttatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgagagctctaacc |
43856344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 94563 - 94462
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || || |||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
94563 |
ttggtagggatattg-catattatatgcaggagccggagttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggct |
94465 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
94464 |
act |
94462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 2787133 - 2787032
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
2787133 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
2787035 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
2787034 |
act |
2787032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 8265286 - 8265387
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
8265286 |
ttggtagggatattg-catattatatgcaggggtcagggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggct |
8265384 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
8265385 |
act |
8265387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 10736926 - 10736825
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
10736926 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
10736828 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
10736827 |
act |
10736825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 23858215 - 23858316
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| || |||||||||| ||||| || | || | |||||||||||||||||||||||| || ||| ||| |
|
|
| T |
23858215 |
ttggtagggatattg-catattatatgcaggggccggagttcgaaccctggacactccaattctccacaatttaattgtgtgagttctagccactaggct |
23858313 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
23858314 |
act |
23858316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 26022265 - 26022346
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||| |||| || |||| | |||||||||||||||||| |
|
|
| T |
26022265 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccagacactccacttctccacaatttaattgtgtga |
26022346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 37717381 - 37717482
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
37717381 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
37717479 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
37717480 |
act |
37717482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 44444562 - 44444645
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagtt |
236 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||| | ||||| ||||||||||||||| |
|
|
| T |
44444562 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccggacaccccacttctccacaa-ttaattgtgtgagtt |
44444645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 10573119 - 10573206
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||| ||| || |||| | ||||||||||||||| ||| |||| |
|
|
| T |
10573119 |
ttggtagggatattg-catattatatgcaggggttggggttcgaaccccgaacactccacttctccacaatttaattgtgcgagctcta |
10573206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 38344067 - 38344154
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
38344067 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctcta |
38344154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 43656054 - 43656141
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| |||||||||||| ||||||||| |||| | ||||||||||||||||||| |||| |
|
|
| T |
43656054 |
ttggtagggatattg-catattatatgtaggggtcggggttcgaacctcggacattccacttctccacaatttaattgtgtgagctcta |
43656141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 5038576 - 5038658
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||| ||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
5038576 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccctggacactccacttctccacaattaaattgtgtgag |
5038658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 6280498 - 6280580
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| | |||||||||||||| || ||||||||||||||||||| || |||| | |||| |||||||||||||| |
|
|
| T |
6280498 |
ttggtagggatattga-atattatatgcaggagccggggttcgaaccccggacactccacttctccacagtttaattgtgtgag |
6280580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 6659307 - 6659389
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
6659307 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgag |
6659389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 6739709 - 6739791
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
6739709 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgag |
6739791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 34472315 - 34472405
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||| |||| || |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
34472315 |
ttggtagggatattg-catattatatgcaggagttggggttcgaaccccagacactccacttttccacaattaaattgtgtgagctctaacc |
34472405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 38402269 - 38402358
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| |||||||| ||||||||| |||| |||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
38402269 |
ttggtagggatattg-catattatttgcaggggttggggttcaaaccccggatattccacttcttcacaatt-aattgtgtgagctctaacc |
38402358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 166 - 253
Target Start/End: Complemental strand, 43085261 - 43085174
Alignment:
| Q |
166 |
acatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| || |||| | ||||||| |||||||| || ||||||| ||| |||||| |
|
|
| T |
43085261 |
acattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtaagctctaaccactaggctact |
43085174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 253
Target Start/End: Original strand, 257576 - 257658
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
257576 |
ttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgtgtgagctctagccactaggctact |
257658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 658344 - 658262
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
658344 |
ttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgtgtgagctctagccactaggctact |
658262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 844080 - 843998
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
844080 |
ttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgtgtgagctctagccactaggctact |
843998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 7816421 - 7816522
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| | |||||||||||||| || |||||||||||| |||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
7816421 |
ttggtagggatattga-atattatatgcaggagccggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
7816519 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
7816520 |
act |
7816522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 8034464 - 8034363
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| || |||| | |||| | ||||||| |||||||||||||||| || ||| ||| |
|
|
| T |
8034464 |
ttggtagggatattg-catattatatgcaggggccggggttcgaacaccagacaccccacttctccacaattaaattgtgtgagttctagccactaggct |
8034366 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
8034365 |
act |
8034363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 13406618 - 13406719
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || || |||||||||| ||||| || |||| | ||||||| ||||||||||| |||| || ||||||| |
|
|
| T |
13406618 |
ttggtagggatattg-catattatatgcaggagccggagttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactatgct |
13406716 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
13406717 |
act |
13406719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 14876639 - 14876553
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||| || |||| | |||||| |||||||||||| ||||||| ||| |||||| |
|
|
| T |
14876639 |
catattatatgcaggagccggggttcgaacctcggacactccacttctccacaatataattgtgtgagctctaaccactaggctact |
14876553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 17698540 - 17698641
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||| |||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
17698540 |
ttggtagggatattg-catattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
17698638 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
17698639 |
act |
17698641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 28909483 - 28909584
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
28909483 |
ttggtagggatattg-catattacatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
28909581 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
28909582 |
act |
28909584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 29514644 - 29514745
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| ||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
29514644 |
ttggtagggatattgt-atattatatgcaggagctggggttcaaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
29514742 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
29514743 |
act |
29514745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 31451009 - 31450908
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||| ||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
31451009 |
ttggtagggatattg-catattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
31450911 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
31450910 |
act |
31450908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 32719659 - 32719559
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||| |||||||| || |||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
32719659 |
ttggtagggatattg-catattatatgcagggt-tggggttcgaatcccggacactccacttttccacaattaaattgtgtgagctctaaccactaggct |
32719562 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
32719561 |
act |
32719559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 34266030 - 34266131
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||| |||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
34266030 |
ttggtagggatattg-catattatatgcaggagttggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
34266128 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
34266129 |
act |
34266131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 34894387 - 34894488
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | |||| || ||||||||||| |||| || ||| ||| |
|
|
| T |
34894387 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctccacagttaaattgtgtgagctctagccactaggct |
34894485 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
34894486 |
act |
34894488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 38219620 - 38219519
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
38219620 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
38219522 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
38219521 |
act |
38219519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 1337152 - 1337080
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
1337152 |
catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
1337080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 6942568 - 6942496
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
6942568 |
catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
6942496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 8862178 - 8862091
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||| ||||||| || |||| | |||||||||||||||| ||||||| |
|
|
| T |
8862178 |
ttggtagggatattg-catattatatgcaggggtcagggttcgaactccggacactccacttttccacaatttaattgtgtaagttcta |
8862091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 251
Target Start/End: Complemental strand, 12273714 - 12273630
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgcta |
251 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||||| | | || | ||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
12273714 |
catattatatacagggactggggttcgaaccctggacacttcatttatccacaatttaattgtgtgagttctaaccactaggcta |
12273630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 42880966 - 42881053
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
42880966 |
ttggtagggatattg-catattatatgtaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
42881053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 43284018 - 43283931
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || | || | ||||||| ||||||||||| |||| |
|
|
| T |
43284018 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctcta |
43283931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 7797148 - 7797230
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| | |||||||||||||| || ||||||||||||||||||| || |||| | ||||||| |||||| |||| |
|
|
| T |
7797148 |
ttggtagggatattga-atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtatgag |
7797230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 43980350 - 43980283
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| || |||| | ||||||||||||||||||| |
|
|
| T |
43980350 |
catattatatgcagggatcggggttcgaaccccggacactcaacttctccacaatttaattgtgtgag |
43980283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 233
Target Start/End: Complemental strand, 4615728 - 4615647
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||| ||||| |||||| || |||| ||||||||| |||||||||| |
|
|
| T |
4615728 |
ttggtagggatattg-catattatatgcaggagcttgggtttgaacctcggacactccacttcttcacaattaaattgtgtga |
4615647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 5328619 - 5328518
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||| | ||||||| || |||||||| |||| || ||| ||| |
|
|
| T |
5328619 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacacctcacttctccacaattaaaatgtgtgagctctagccactaggct |
5328521 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
5328520 |
act |
5328518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 16432180 - 16432079
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||| |||||| || |||| | || |||||||||||||||| |||| || ||| ||| |
|
|
| T |
16432180 |
ttggtagggatattg-catattatatgcaggagccggggttcgaacatcggacactccacttctccataatttaattgtgtgagctctagccactaggct |
16432082 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
16432081 |
act |
16432079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 17072600 - 17072514
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| | |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
17072600 |
catattatatgcaggggccggggttcgaaccccgaacaccccacttctccacaattaaattgtgtgagctctagccactaggctact |
17072514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 17575671 - 17575757
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| | |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
17575671 |
catattatatgcaggggccggggttcgaaccccgaacaccccacttctccacaattaaattgtgtgagctctagccactaggctact |
17575757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 22274663 - 22274563
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| | |||| | ||||| ||||||||||||| |||| || ||| ||| |
|
|
| T |
22274663 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacaccccacttctccacaa-ttaattgtgtgagctctagccactaggct |
22274566 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
22274565 |
act |
22274563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 37290955 - 37291041
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
37290955 |
catattatatgcaggggccggcgttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctact |
37291041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 43186871 - 43186972
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || || ||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
43186871 |
ttggtagggatattg-catattatatgcaggagccaggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
43186969 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
43186970 |
act |
43186972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 5332934 - 5333021
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||| |||||| | |||||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
5332934 |
ttggtagagatatt-atatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
5333021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 7388473 - 7388560
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||| ||| ||| ||| || | || | ||||||||||||||||||| |||| |
|
|
| T |
7388473 |
ttggtagggatattg-catattatatgcaggggttggggttcaaactccgaacactccatttctccacaatttaattgtgtgagctcta |
7388560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 8953921 - 8953835
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
8953921 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactc-acttctccacaattaaattgtgtgagctcta |
8953835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 242
Target Start/End: Original strand, 8969128 - 8969204
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatt-taattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||| || |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
8969128 |
catattatatgcaggagctggggttcgaacctcggacactccacttctccacaattaaaattgtgtgagctctaacc |
8969204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 242
Target Start/End: Complemental strand, 11289476 - 11289385
Alignment:
| Q |
150 |
tttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||| |||||||||| ||| ||||||| |||||||||||||||||||| |||||||| |||| | ||||||| |||| ||| || ||||||| |
|
|
| T |
11289476 |
tttgatagggatattg-cattttatatgtaggggctggggttcgaaccctggacattccacttctccacaattaaattatgtcagctctaacc |
11289385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 13647494 - 13647422
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| | | ||||||||||||||||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
13647494 |
catattatatgcaggagtcgtggttcgaaccccggacactccacttctccacaatttaattgtgtgagctcta |
13647422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 13747919 - 13747847
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| | | ||||||||||||||||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
13747919 |
catattatatgcaggagtcgtggttcgaaccccggacactccacttctccacaatttaattgtgtgagctcta |
13747847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 44673700 - 44673613
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| |||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
44673700 |
ttggtagggatatc-acattttatatgcaggggtcggggttcgaaccccagacactccacttttccacaattaaattgtgtgagctcta |
44673613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 6511553 - 6511478
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||| ||||| ||||||| | ||||||||||| ||| || |||| ||||||||||||||||||||| ||||||| |
|
|
| T |
6511553 |
catataatatgtaggggctcgagttcgaaccccagacgctccacttcttcacaatttaattgtgtgagctctaacc |
6511478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 222
Target Start/End: Original strand, 7194280 - 7194350
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatt |
222 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| |
|
|
| T |
7194280 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaatt |
7194350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 7765661 - 7765743
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||| ||||||| |||||||||||||||| || |||||||||||||| |||| || | || | ||||||| ||||||||||| |
|
|
| T |
7765661 |
ttggtatggatatt-acatattatatgcaggagccggggttcgaaccccagacactccatttctccacaattaaattgtgtgag |
7765743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 10200718 - 10200651
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| || |||| | || |||| ||||||||||| |
|
|
| T |
10200718 |
catattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgtgtgag |
10200651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 23435270 - 23435203
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| | || |||| | |||| |||||||||||||| |
|
|
| T |
23435270 |
catattatatgcaggagccggggttcgaaccccggatactccacttctccacagtttaattgtgtgag |
23435203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 239
Target Start/End: Original strand, 24458351 - 24458421
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| | || |||| | ||| ||||||||||||||| |||| |
|
|
| T |
24458351 |
atattatatgcaggggccggggttcgaaccccggatactcaacttctccac-atttaattgtgtgagctcta |
24458421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 27077149 - 27077067
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||| |||||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
27077149 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaatcccggacaccccacttctccacaattaaattgtgtgag |
27077067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 37708708 - 37708791
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||| |||||||||||||||||||| | |||| | |||| || || |||||||| |
|
|
| T |
37708708 |
ttggtagggataagtgcattttatatgcaggggccggggttcgaaccccggacatcccacttctccacatttaaaatgtgtgag |
37708791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 41458313 - 41458394
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||| |||||| || |||| | ||| |||||| |||||||| |
|
|
| T |
41458313 |
ttggtagggatattg-catattatatgcaggggctgggtttcgaacctcggacactccacttctccac-atttaaatgtgtgag |
41458394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 1937328 - 1937429
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||| ||| || |||| | |||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
1937328 |
ttggtagggatattg-catattatatgcaggaggcggggttcgaaccccgcacactccacttctctacaattaaattgtgtgagctctagccactaggct |
1937426 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
1937427 |
act |
1937429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 9187275 - 9187174
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||| |||||||||||||| ||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
9187275 |
ttggtagggatatt-acattttatatgctggggtcggggttcgaacccccaacactccacttctccacaattaaattgtgtgagctctagccactaggct |
9187177 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
9187176 |
act |
9187174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 10030445 - 10030531
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | ||| || |||| | ||||| |||| ||||||||||||| || ||| |||||| |
|
|
| T |
10030445 |
catattatatgcaggtgccggggttcgaaccctgaacactccacttctccacaagttaactgtgtgagttctagccactaggctact |
10030531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 10568103 - 10568204
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| |||||| |||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
10568103 |
ttggtagggatattg-catattaaatgcaggggaaggggtttgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
10568201 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
10568202 |
act |
10568204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 11787169 - 11787270
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||| ||||||| ||||||||||| |||||| | ||||| ||||||||||| || |||| | ||||||| |||| |||||| ||||||| ||| ||| |
|
|
| T |
11787169 |
ttggtatggatatt-acatattatatataggggccgtggttcaaaccccggacactccacttctccacaattaaattatgtgagctctaaccactaggct |
11787267 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
11787268 |
act |
11787270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 173 - 239
Target Start/End: Original strand, 23261340 - 23261406
Alignment:
| Q |
173 |
atatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
23261340 |
atatgcagggaccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
23261406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 28420461 - 28420375
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||| || || ||||||||||||||||||| || |||| | ||| ||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
28420461 |
catattatatgctggagccggggttcgaaccccggacactccacttctccacgattaaattgtgtgagctctagccactaggctact |
28420375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 35939505 - 35939606
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||| |||| ||||| | |||| ||||||| |||||||||||||||| || ||| ||| |
|
|
| T |
35939505 |
ttggtagggatattg-catattatatgcaggggccggggttcaaaccgtggacaccccacttcaccacaattaaattgtgtgagttctagccactaagct |
35939603 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
35939604 |
act |
35939606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 183 - 253
Target Start/End: Original strand, 39169534 - 39169604
Alignment:
| Q |
183 |
gctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||| |||| || |||| | ||||||||||||||||||| |||| || ||| |||||| |
|
|
| T |
39169534 |
gctggggttcgaaccccagacactcaacttctccacaatttaattgtgtgagctctagccactaggctact |
39169604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 168 - 233
Target Start/End: Complemental strand, 23339932 - 23339867
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||| |||||| ||||||||||||| ||||| | |||| ||||||||| |||||||||| |
|
|
| T |
23339932 |
atattatatgtaggggccggggttcgaaccctggacaccccacttcttcacaattaaattgtgtga |
23339867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 24790376 - 24790324
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
24790376 |
ttggtagggatatt-acatattatatgtaggggttggggttcgaaccctggaca |
24790324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 29729136 - 29729224
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaacccc-ggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||| |||||| | ||||||||||||| |||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
29729136 |
ttggtagggatattg-catattatatacaggggttagggttcgaaccccaagacactccacttctccacaatttaattgtgtgagctcta |
29729224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 42006796 - 42006880
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagtt |
236 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || | ||||||||||| | | | || |||| | ||||||||||||||||||||| |
|
|
| T |
42006796 |
ttggtagggatattg-catattatatgcaggagccgtggttcgaaccctgaatactccacttctccacaatttaattgtgtgagtt |
42006880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 3227252 - 3227339
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||| |||||| | ||||| ||||||||| ||| ||||||||||||| |||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
3227252 |
ttggtagagatatt-agatattttatgcagggactgaggttcgaaccccgaacatcccacttctccacaattaaattgtgtgagctcta |
3227339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 18926168 - 18926100
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
18926168 |
ttatatgcaggggcagggattcgaaccccggacacttcacttctccacaattaaattgtgtgagctcta |
18926100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 205
Target Start/End: Original strand, 25119240 - 25119276
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacat |
205 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25119240 |
tattatatgcaggggttggggttcgaaccccggacat |
25119276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 33473407 - 33473320
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||| |||||||||||| |||||||||| |||||||| | |||| ||||||||| ||||||||||| |||| |
|
|
| T |
33473407 |
ttggtagggatatc-acattttatatgcagggatcggggttcgaatcccggacacttcacttcttcacaattaaattgtgtgagctcta |
33473320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 34158709 - 34158622
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||| | | || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
34158709 |
ttggtagggatattg-catattatatgcaggaggcggggttcgaaccccgcatactccacttctccacaattaaattgtgtgagctcta |
34158622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 231
Target Start/End: Original strand, 37669704 - 37669783
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |||||| ||||||||||| |||| || |||| | ||||||| |||||||| |
|
|
| T |
37669704 |
ttggtagggatattg-cattttatatgcagtggctggagttcgaaccccagacactccacttctccacaattaaattgtgt |
37669783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 43403325 - 43403397
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| |||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
43403325 |
catattatatgtaggggctggagttcgaaccttggacatcccacttctccacaattaaattgtgtgagctcta |
43403397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 2696565 - 2696600
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2696565 |
tattatatgcaggggccggggttcgaaccccggaca |
2696600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 2800051 - 2800086
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2800051 |
tattatatgcaggggccggggttcgaaccccggaca |
2800086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 4798604 - 4798569
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4798604 |
tattatatgcaggggccggggttcgaaccccggaca |
4798569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 5184950 - 5184915
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5184950 |
tattatatgcaggggctggggttcgaaccctggaca |
5184915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 8698632 - 8698543
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| ||||||||||| |||||||| | |||| ||||| |||||| | |||||| ||||||| |
|
|
| T |
8698632 |
ttggtagggatattg-catattatatgtaggggttggggttcgaatcccggacaccccacttcttcac-atttaaatatgtgagctctaacc |
8698543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 9370186 - 9370268
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||| |||| | ||||||| ||||||||||| |
|
|
| T |
9370186 |
ttggtagggatattg-catattatatgcaggggtcagggttcgaaccccggacacctcacttatccacaattaaattgtgtgag |
9370268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 15042428 - 15042393
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15042428 |
tattatatgcaggggccggggttcgaaccccggaca |
15042393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 17980314 - 17980349
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17980314 |
tattatatgcaggggccggggttcgaaccccggaca |
17980349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 24296917 - 24296836
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||| ||| | |||| | ||||||| |||||||||||||||| |
|
|
| T |
24296917 |
gtagggatattg-catattatatgcaggggttggggttcgaaccc---acaccccacttctccacaattaaattgtgtgagttcta |
24296836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 168 - 239
Target Start/End: Complemental strand, 24480857 - 24480786
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| | |||| | ||||||| |||| |||||| |||| |
|
|
| T |
24480857 |
atattatatgcaggggctggggttcgaaccttggacaccccacttctccacaattaaattatgtgagctcta |
24480786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 28378844 - 28378879
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28378844 |
tattatatgcaggggctgaggttcgaaccccggaca |
28378879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 152 - 239
Target Start/End: Original strand, 29260638 - 29260724
Alignment:
| Q |
152 |
tggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||| | |||| |||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
29260638 |
tggtagggatattg-catattatatgcaggagtcggggctcgaaccccggacacttcacttctccacaattaaattgtgtgagctcta |
29260724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 37535551 - 37535461
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||| | |||||||||||||||||| || | || | |||||||||||||||||| ||||||| |
|
|
| T |
37535551 |
ttggtagggatattg-catattatatgcagaagtcagggttcgaaccccggacactccatttctccacaatttaattgtgtgaactctaacc |
37535461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 202
Target Start/End: Complemental strand, 41616418 - 41616368
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccgga |
202 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41616418 |
ttggtagggatattgt-atattatatgcaggggccggggttcgaaccccgga |
41616368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 43053937 - 43053855
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||||||| |||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
43053937 |
ttggtagggatattt-catattatatgcaggagtcggggttcgaatttcggacactccacttctccacaattaaattgtgtgag |
43053855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 238
Target Start/End: Complemental strand, 405025 - 404955
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttct |
238 |
Q |
| |
|
||||||||| |||||||||| ||||||||| | |||| |||| |||||||||||||||| |||||||| |
|
|
| T |
405025 |
atattatatacaggggctggagttcgaacctctaacatctcactttttcacaatttaattgtctgagttct |
404955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 242
Target Start/End: Original strand, 7453371 - 7453460
Alignment:
| Q |
152 |
tggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||| ||||||||||||||||||| | |||| | || |||| |||||||||| ||||||| |
|
|
| T |
7453371 |
tggtagggatattg-cattttatatgtaggggccggggttcgaaccccggacaccccacttctccataattaaattgtgtgaactctaacc |
7453460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 7763976 - 7763890
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| ||| || |||| ||||||| | |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
7763976 |
catattatatgcaggggccgggatttgaactccggacaccccacttctccacaattaaattgtgtgagctctagccactaagctact |
7763890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 253
Target Start/End: Original strand, 11127955 - 11128021
Alignment:
| Q |
187 |
gggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
11127955 |
gggttcgaaccccggacactccacttttccacaattaaattgtgtgagctctagccactaggctact |
11128021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 11483153 - 11483238
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||| || |||| | ||||||| |||||| |||| |||| || ||| |||||| |
|
|
| T |
11483153 |
catattatatgcaggagc-ggggttcgaacctcggacactccacttctccacaattaaattgtatgagctctagccgctaggctact |
11483238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 242
Target Start/End: Original strand, 13450479 - 13450556
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| |||| || |||| | ||||||| ||||| ||||| ||||||| |
|
|
| T |
13450479 |
ttacatattatatgcagaggccagggttcgaaccccagacactccacttctccacaattaaattg-gtgagctctaacc |
13450556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 17027932 - 17027832
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||| || || |||||||||| |||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
17027932 |
ttggtagggatattg-catattatatgccggagccggggttcgaa-cccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
17027835 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
17027834 |
act |
17027832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 17558368 - 17558268
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||| || || |||||||||| |||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
17558368 |
ttggtagggatattg-catattatatgccggagccggggttcgaa-cccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
17558271 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
17558270 |
act |
17558268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 204
Target Start/End: Complemental strand, 34812557 - 34812527
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34812557 |
tatgcaggggctggggttcgaaccccggaca |
34812527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 233
Target Start/End: Complemental strand, 38620393 - 38620312
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| |||||||||||||| || ||| ||||||||||| ||| || |||| | ||||||| |||||||||| |
|
|
| T |
38620393 |
ttggtagggatattgt-atattatatgcaggagccgggattcgaaccccgaacactccacttctccacaattaaattgtgtga |
38620312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 40298729 - 40298791
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||| || ||| | |||||||||||||||||| |
|
|
| T |
40298729 |
ttatatgcaagggtcggggttcgaaccccggacactccgcttctccacaatttaattgtgtga |
40298791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 242
Target Start/End: Complemental strand, 42801685 - 42801611
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||||| | |||| | || |||| ||||||||||||||||||| |
|
|
| T |
42801685 |
atattatatgtaggggtcggggttcgaacctcggacaccccacttctccataattaaattgtgtgagttctaacc |
42801611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 155 - 204
Target Start/End: Complemental strand, 2294147 - 2294099
Alignment:
| Q |
155 |
tagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
2294147 |
tagggatatt-acatattatatgcaggggtcggggttcgaaccccagaca |
2294099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 4654147 - 4654074
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaacccc-ggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||| |||||||||||| ||||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
4654147 |
catattatatgcaagggccaaggttcgaacccctggacactccacttctccacaatttaattgtgtgagctcta |
4654074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 5683787 - 5683824
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
5683787 |
catattatatgcaggggttggggttcgaaccccagaca |
5683824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 218
Target Start/End: Original strand, 9524989 - 9525038
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| |||||| ||||| |
|
|
| T |
9524989 |
tattatatgcaggggccggggttcgaaccccagacaccctacttattcac |
9525038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 10083181 - 10083233
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
10083181 |
ttggtagggatattg-catattatatgcaggggtcgaggttcgaaccccggaca |
10083233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 216 - 253
Target Start/End: Original strand, 11710366 - 11710403
Alignment:
| Q |
216 |
cacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
11710366 |
cacaatttaattgtgtgagttctaaccactaggctact |
11710403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 174 - 239
Target Start/End: Original strand, 12770408 - 12770472
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | |||| | ||| ||||||||||||||| |||| |
|
|
| T |
12770408 |
tatgcaggggccggggttcgaaccccggacaccccacttctccac-atttaattgtgtgagctcta |
12770472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 20540143 - 20540106
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20540143 |
catattatatgcaggggctggggttcgaattccggaca |
20540106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 218
Target Start/End: Complemental strand, 24608546 - 24608497
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| |||||| ||||| |
|
|
| T |
24608546 |
tattatatgcaggggccggggttcgaaccccagacaccctacttattcac |
24608497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 26192768 - 26192716
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||||||||||||| || ||||||||||||||||||| |
|
|
| T |
26192768 |
ttggtagggatattg-catattatatgcagaggtcggggttcgaaccccggaca |
26192716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 168 - 253
Target Start/End: Complemental strand, 29734041 - 29733956
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| | || |||| | |||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
29734041 |
atattatatgcaggagtcggggttcgaaccccggatactccacttctctacaattaaattgtgtgagctctagccactaggctact |
29733956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 31024331 - 31024364
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
31024331 |
ttatacgcaggggctggggttcgaaccccggaca |
31024364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 33604196 - 33604143
Alignment:
| Q |
186 |
ggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||| |||||||| || |||| | ||||||| |||||||||||||||| |
|
|
| T |
33604196 |
ggggttcgaatcccggacactccacttctccacaattaaattgtgtgagttcta |
33604143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 205
Target Start/End: Original strand, 37838596 - 37838648
Alignment:
| Q |
152 |
tggtagggatatttacatattatatgcaggggctggggttcgaaccccggacat |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
37838596 |
tggtagggatattg-catattatatgcaggggccagagttcgaaccccggacat |
37838648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 166 - 239
Target Start/End: Complemental strand, 39674096 - 39674024
Alignment:
| Q |
166 |
acatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| ||||| | |||| ||||| |||||||||| |||| |||| |
|
|
| T |
39674096 |
acatgttatatgcaggggttggggttcgaaccctggacaccccacttcttcac-atttaattgtatgagctcta |
39674024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 200
Target Start/End: Complemental strand, 45190596 - 45190563
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccg |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
45190596 |
catattatatgcaggggctgaggttcgaaccccg |
45190563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 217
Target Start/End: Complemental strand, 8740719 - 8740671
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttca |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||| |||||| |||| |
|
|
| T |
8740719 |
tattatatgcaggggctgaggttcgaactccggacaccctacttattca |
8740671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 227
Target Start/End: Complemental strand, 10594268 - 10594193
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaatt |
227 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| || ||||||||||||||| ||| || |||| | ||||||| |||| |
|
|
| T |
10594268 |
ttggtagggatattg-cattttatatgcaggagccggggttcgaaccccgtacactccacttctccacaattaaatt |
10594193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 204
Target Start/End: Complemental strand, 11537467 - 11537427
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
11537467 |
ttacatattatatgcaggagcccgggttcgaaccccggaca |
11537427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 30972869 - 30972783
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||| || || ||| |||||| |||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
30972869 |
ttggtagggatattg-catattatatgccggagccggg-ttcgaatcccggacactccacttctccacaattaaattgtgtgagctcta |
30972783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 236
Target Start/End: Complemental strand, 41865122 - 41865051
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagtt |
236 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||| || | || | ||| ||||||||||||||||| |
|
|
| T |
41865122 |
ttacatattatatgcaggggtcagggttcgaaccccagacactccatttttccac-atttaattgtgtgagtt |
41865051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 204
Target Start/End: Complemental strand, 45281362 - 45281330
Alignment:
| Q |
172 |
tatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
45281362 |
tatatgcaggggttggggttcgaaccccggaca |
45281330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 132)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 7166279 - 7166178
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
7166279 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggct |
7166181 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
7166180 |
act |
7166178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 13538498 - 13538397
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| || |||| | |||||||||||||||||||||||| || |||| || |
|
|
| T |
13538498 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagttctagccactatact |
13538400 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
13538399 |
act |
13538397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 18467250 - 18467149
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
18467250 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggct |
18467152 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
18467151 |
act |
18467149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 22563404 - 22563505
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
22563404 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggct |
22563502 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
22563503 |
act |
22563505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 11215019 - 11215120
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||| |||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
11215019 |
ttggtagggatattg-catattatatgcaggggctgaggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggct |
11215117 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
11215118 |
act |
11215120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 19011373 - 19011474
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| || | || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
19011373 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaattgtgtgagctctagccactaggct |
19011471 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
19011472 |
act |
19011474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 40375367 - 40375266
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||| ||||||||||||| ||||||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
40375367 |
ttggtagggatattg-catattatatgcaggagccggggtacgaaccccggacactctacttctccacaattaaattgtgtgagctctaaccactaggct |
40375269 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
40375268 |
act |
40375266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 47930723 - 47930622
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |||| | | |||| ||||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
47930723 |
ttggtagggatattg-catattatatgcaggggctggggttcgaacctcggataccccacttcttcacaattaaattgtgtgagctctaaccactaggct |
47930625 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
47930624 |
act |
47930622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 51050208 - 51050309
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||| ||||||| |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
51050208 |
ttggtagggatattgt-atattatatgcaggggatggggttcgaaccccagacattccacttctccacaatttaattgtgtgagctctagccactaggct |
51050306 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
51050307 |
act |
51050309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 25999868 - 25999955
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
25999868 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
25999955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 34580838 - 34580748
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||| | ||||| | |||||||||||||| |||| ||||||| |
|
|
| T |
34580838 |
ttggtagggatattgt-atattatatgcaggagctggggttcgaaccccggacactttacttctccacaatttaattgtatgagctctaacc |
34580748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 50824462 - 50824380
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| || ||| ||||||||| ||||||||||| |
|
|
| T |
50824462 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccggacactccactccttcacaattaaattgtgtgag |
50824380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 1570244 - 1570143
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
1570244 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
1570146 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
1570145 |
act |
1570143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 2556574 - 2556655
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| | || | ||||||||||||||||| |
|
|
| T |
2556574 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagacattccatttctctacaatttaattgtgtga |
2556655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 6438116 - 6438015
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
6438116 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
6438018 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
6438017 |
act |
6438015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 15390238 - 15390339
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| |||| ||||||||| ||||| || |||| | |||||||||||||||||||||||| || ||| ||| |
|
|
| T |
15390238 |
ttggtagggatattg-catattagatgcaggggttgggattcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggct |
15390336 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
15390337 |
act |
15390339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 15819653 - 15819552
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
15819653 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
15819555 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
15819554 |
act |
15819552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 16343046 - 16343147
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
16343046 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaagct |
16343144 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
16343145 |
act |
16343147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 21265674 - 21265775
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
21265674 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
21265772 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
21265773 |
act |
21265775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 172 - 253
Target Start/End: Complemental strand, 45333744 - 45333663
Alignment:
| Q |
172 |
tatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| || |||| | ||||||||||||||||||| |||| || ||| |||||| |
|
|
| T |
45333744 |
tatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctact |
45333663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 2754378 - 2754465
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| ||||||||||||||||||| |||||| | ||||||| ||||||||||| |||| |
|
|
| T |
2754378 |
ttggtagggatattg-catattatatgccggggccggggttcgaaccccggacaccctacttctccacaattaaattgtgtgagctcta |
2754465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 3560433 - 3560346
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| ||||||||||| || | || |||| | ||||||||||||||||||| |||| |
|
|
| T |
3560433 |
ttggtagggatatt-atatattatatgcaggggctggagttcgaaccccagatactccacttctccacaatttaattgtgtgagctcta |
3560346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 42054351 - 42054438
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| ||||||||||||| |||||||| |||| | |||||||||| |||||||| |||| |
|
|
| T |
42054351 |
ttggtagggatattg-catattatatgtaggggccggggttcgaaccctggacattccacttctccacaatttaactgtgtgagctcta |
42054438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 43884812 - 43884899
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||| ||||| || |||| | ||||||| |||||||||||||||| |
|
|
| T |
43884812 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagttcta |
43884899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 238
Target Start/End: Original strand, 8865872 - 8865958
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttct |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||| ||||||||| ||||| || |||| | ||||||||||||||||||||||| |
|
|
| T |
8865872 |
ttggtagggatattg-catattatatgcaggggtcgggattcgaaccctggacactccacttctccacaatttaattgtgtgagttct |
8865958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 254
Target Start/End: Complemental strand, 42490462 - 42490360
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| |||||||||| ||||||| ||| ||| |
|
|
| T |
42490462 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaaccccggacaccccacttctccacaattaaattgtgtgaactctaaccactaggct |
42490364 |
T |
 |
| Q |
251 |
actc |
254 |
Q |
| |
|
|||| |
|
|
| T |
42490363 |
actc |
42490360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 43667994 - 43667919
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||| |||| | ||||||| ||||||||||||||||||| |
|
|
| T |
43667994 |
catattatatgcaggaaccggggttcgaaccccgaacattccacttctccacaattaaattgtgtgagttctaacc |
43667919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 150 - 253
Target Start/End: Complemental strand, 48897170 - 48897068
Alignment:
| Q |
150 |
tttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgc |
249 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| |||||||||| ||||||| || |||| | || |||||||||||||||| ||||||| ||| || |
|
|
| T |
48897170 |
tttggtaggaatattg-catattatatgcaggggccagggttcgaacaccggacactccacttctccataatttaattgtgtgagctctaaccactaggc |
48897072 |
T |
 |
| Q |
250 |
tact |
253 |
Q |
| |
|
|||| |
|
|
| T |
48897071 |
tact |
48897068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 2277772 - 2277873
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||| | || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
2277772 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggagactccacttctccacaattaaattgtgtgagctctagccactaggct |
2277870 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
2277871 |
act |
2277873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 12048176 - 12048075
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
12048176 |
ttggtagggatattgt-atattatatgcaggggctggggttcgaatcccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
12048078 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
12048077 |
act |
12048075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 13773186 - 13773287
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||| |||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
13773186 |
ttggtagggatattg-catattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
13773284 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
13773285 |
act |
13773287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 241
Target Start/End: Complemental strand, 19063370 - 19063296
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||| | |||| | ||||||||||||||||||| |||||| |
|
|
| T |
19063370 |
catattatatgcaggggccggggttcgtaccccggacaccccacttctccacaatttaattgtgtgagctctaac |
19063296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 32594269 - 32594370
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
32594269 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
32594367 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
32594368 |
act |
32594370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 164 - 242
Target Start/End: Original strand, 35283531 - 35283609
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| | ||| || |||| | ||||||||||||||||||| ||||||| |
|
|
| T |
35283531 |
ttacatattatatgcagaggccggggttcgaaccctgaacactccacttctccacaatttaattgtgtgagctctaacc |
35283609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 46965758 - 46965859
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | || |||| ||||||||||| |||| || ||| ||| |
|
|
| T |
46965758 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgtgtgagctctagccactaggct |
46965856 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
46965857 |
act |
46965859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 3269637 - 3269730
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||| || ||| ||| |
|
|
| T |
3269637 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccctggaca--------gtccacaatttaattgtgtgagttctagccactaggct |
3269727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 1151777 - 1151864
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||| |||| || ||| ||||||||||||||| || |||| ||||||||| ||||||||||| |||| |
|
|
| T |
1151777 |
ttggtagggatattg-catattatatacaggagccgggattcgaaccccggacactccacttcttcacaattaaattgtgtgagctcta |
1151864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 6702594 - 6702681
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||||||||||| |||| || |||| ||||||||| ||||||||||| |||| |
|
|
| T |
6702594 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccagacactccacttcttcacaattaaattgtgtgagctcta |
6702681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 7191065 - 7191137
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| | ||||||| ||||||||||| |||| |
|
|
| T |
7191065 |
catattatatgcaggggctggggttcgaaccccggacacctcacttctccacaattaaattgtgtgagctcta |
7191137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 29188654 - 29188741
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||| | || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
29188654 |
ttggtagggatattg-catattatatgcaggagcaggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctcta |
29188741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 34058232 - 34058319
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || | ||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
34058232 |
ttggtagggatattg-catattatatgcaggagccgaggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
34058319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 39347012 - 39346944
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| || ||||||||||||||||||| || |||| | ||||||| |||||||||||||||| |
|
|
| T |
39347012 |
ttatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagttcta |
39346944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 231
Target Start/End: Original strand, 40520848 - 40520927
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||| |||| || || | | |||||||||||||||| |
|
|
| T |
40520848 |
ttggtagggatattg-catattatatgcatgggctggggttcgaaccccagacactccacctctccacaatttaattgtgt |
40520927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 6893289 - 6893207
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | ||||||||||||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
6893289 |
ttggtagggatattg-cattttatatgcaggggccgaggttcgaaccccggacactccacttttccacaattaaattgtgtgag |
6893207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 40519596 - 40519494
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctgggg-ttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgc |
249 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||| ||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| || |
|
|
| T |
40519596 |
ttggtagggatattg-catattatatgcaggagccgggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggc |
40519498 |
T |
 |
| Q |
250 |
tact |
253 |
Q |
| |
|
|||| |
|
|
| T |
40519497 |
tact |
40519494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 4482650 - 4482549
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || || |||||||||||||| | || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
4482650 |
ttggtagggatattg-catattatatgcaggagccggagttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactaggct |
4482552 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
4482551 |
act |
4482549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 6463069 - 6463007
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| || |||| | |||||||||||| ||||| |
|
|
| T |
6463069 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattatgtga |
6463007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 6712142 - 6712060
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||||||| | ||||||| |||| |||||| |||| || ||| |||||| |
|
|
| T |
6712142 |
ttatatgcaggggccggggttcaaaccccggacactctacttctccacaattaaattatgtgagctctagccactaggctact |
6712060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 12502306 - 12502205
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||||||| |||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
12502306 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaacccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
12502208 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
12502207 |
act |
12502205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 16526229 - 16526128
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || | |||||||||||| ||| || |||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
16526229 |
ttggtagggatattg-catattatatgcaggagcctgtgttcgaaccccgtacactccacttctccacaattaaattgtgtgagctctaaccactaggct |
16526131 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
16526130 |
act |
16526128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 18551670 - 18551584
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||| || |||| | ||||||| ||||||| ||| ||||||| ||| |||||| |
|
|
| T |
18551670 |
catattatatgcaggggccggggtttgaaccccgaacactccacttctccacaattaaattgtgcgagctctaaccactaggctact |
18551584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 242
Target Start/End: Complemental strand, 32556980 - 32556891
Alignment:
| Q |
152 |
tggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||| |||||||||||||| || |||||||| ||||| |||| ||||||| | ||||||| |||||||||| |||||||| |
|
|
| T |
32556980 |
tggtagggatattg-catattatatgcagaggttggggttcaaacccgagacactctacttctccacaattaaattgtgtgacttctaacc |
32556891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 44732651 - 44732732
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| ||||||||||||||||||| | |||| | ||||||| |||||||||| |
|
|
| T |
44732651 |
ttggtagggatattg-catattatatgcaagggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtga |
44732732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 45517320 - 45517219
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||| ||| || |||||||||||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
45517320 |
ttggtagggatattg-cattttatatacaggggccgggattggaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggct |
45517222 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
45517221 |
act |
45517219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 48638550 - 48638651
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||| |||| | |||| | ||||||| || |||||||| |||| || ||| ||| |
|
|
| T |
48638550 |
ttggtagggatattg-cattttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaactgtgtgagctctagccactaggct |
48638648 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
48638649 |
act |
48638651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 30444 - 30360
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||| ||||||||||| || |||||||||||||||||| || |||| | ||||||| |||||||||||||||| |
|
|
| T |
30444 |
gtagggatattg-cattttatatgcaggagccggggttcgaaccccggacgctccacttctccacaattaaattgtgtgagttcta |
30360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 172 - 253
Target Start/End: Complemental strand, 32589521 - 32589440
Alignment:
| Q |
172 |
tatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||| || |||||||||||||||| || || |||| | ||||||| ||||||||||| ||||||| ||| |||||| |
|
|
| T |
32589521 |
tatatgcaggagccggggttcgaaccccggtcactccacttctccacaattaaattgtgtgagctctaaccactaggctact |
32589440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 33207223 - 33207275
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33207223 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggaca |
33207275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 233
Target Start/End: Complemental strand, 42458242 - 42458174
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| |||||| || |||| | |||||||||||||||||| |
|
|
| T |
42458242 |
ttacatattatatacaggggc-ggggttcgaacctcggacactccacttctccacaatttaattgtgtga |
42458174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 172 - 253
Target Start/End: Complemental strand, 47643014 - 47642933
Alignment:
| Q |
172 |
tatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||| ||| ||||||||||||||| ||| || |||| | ||||||| ||||||||||| |||| || |||||||||| |
|
|
| T |
47643014 |
tatatgcagaggccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctagccactatgctact |
47642933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 6130085 - 6129998
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||| ||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
6130085 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaactccggacactccacttctccacaattaaattgtgtgagctcta |
6129998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 7180651 - 7180579
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
7180651 |
catattatatgcaggggccggagttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
7180579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 9866236 - 9866149
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||| |||| ||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
9866236 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaatcccgaacactccacttttccacaattaaattgtgtgagctcta |
9866149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 15775757 - 15775844
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || || ||||||||||| |||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
15775757 |
ttggtagggatattg-catattatatgcaggagccggagttcgaaccccagacactcaacttctacacaattaaattgtgtgagctcta |
15775844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 18216924 - 18217011
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||| |||||| | || ||||||||||||||||||| || |||| | |||||| ||||||||||| |||| |
|
|
| T |
18216924 |
ttggtagggatatt-acatattttatgcaagagccggggttcgaaccccggacactccacttctctacaattaaattgtgtgagctcta |
18217011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 27234020 - 27234092
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||| ||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
27234020 |
catattatatgcaggggccggggttcgaatcccgaacactccacttctccacaattaaattgtgtgagctcta |
27234092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 33254746 - 33254833
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||| |||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
33254746 |
ttggtagggatattg-catattatatgcaggagtcggggttggaaccccggacactccacttctccacaattaaattgtgtgagctcta |
33254833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 33274918 - 33275005
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||| |||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
33274918 |
ttggtagggatattg-catattatatgcaggagtcggggttggaaccccggacactccacttctccacaattaaattgtgtgagctcta |
33275005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 34656428 - 34656360
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
34656428 |
ttatatgcaggggttggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctcta |
34656360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 51942313 - 51942399
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| | ||||||||||||||||||| | |||| | ||||||||||||||||||| |||| |
|
|
| T |
51942313 |
ttggtagggatattg-catattatatacagggtc-ggggttcgaaccccggacaccccacttctccacaatttaattgtgtgagctcta |
51942399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 253
Target Start/End: Complemental strand, 28564379 - 28564296
Alignment:
| Q |
170 |
attatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| | |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
28564379 |
attatatgcaggggttggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactaggctact |
28564296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 8984542 - 8984457
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
8984542 |
catattatatgcaggagccggggttcgaa-cccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
8984457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 10664846 - 10664746
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||| | | ||||||||||||||||||| || |||| | ||||||| |||||| |||| |||| || ||| ||| |
|
|
| T |
10664846 |
ttggtagggatattg-catattatatgcagagtc-ggggttcgaaccccggacactccacttctccacaattaaattgtatgagctctagccactaggct |
10664749 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
10664748 |
act |
10664746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 18534034 - 18534120
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| ||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
18534034 |
catattatatgtaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
18534120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 26550512 - 26550612
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||| |||||||||| || ||||||||||||||||||| || ||| | ||||||| |||||||| || ||||||| ||| ||| |
|
|
| T |
26550512 |
ttggtagggatattg-catactatatgcaggagccggggttcgaaccccggacactc-ccttctccacaattaaattgtgttagctctaaccactaggct |
26550609 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
26550610 |
act |
26550612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 26584798 - 26584697
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||| ||| || |||| | |||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
26584798 |
ttggtagggatattg-catattatatgcaggaggcggggttcgaaccccgcacactccacttctctacaattaaattgtgtgagctctagccactaggct |
26584700 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
26584699 |
act |
26584697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 201
Target Start/End: Original strand, 40634219 - 40634268
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccgg |
201 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40634219 |
ttggtagggatattg-catattatatgcaggggatggggttcgaaccccgg |
40634268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 174 - 252
Target Start/End: Complemental strand, 47469103 - 47469026
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctac |
252 |
Q |
| |
|
||||||||||||| ||||||||||||||||| | |||| | ||| ||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
47469103 |
tatgcaggggctgaggttcgaaccccggacaccccacttctccac-atttaattgtgtgagctctaaccactaggctac |
47469026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 17671441 - 17671380
Alignment:
| Q |
173 |
atatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||| || |||||||||||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
17671441 |
atatgcaggggccggagttcgaaccccggacactccacttctccacaattaaattgtgtgag |
17671380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 239
Target Start/End: Complemental strand, 18913743 - 18913666
Alignment:
| Q |
162 |
atttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||| |||||||||||||||| ||||||| | |||| |||||| || | || ||||||||| ||||||||||| |||| |
|
|
| T |
18913743 |
atttgcatattatatgcagggactggggtacaaacctcggacactccatttcttcacaattaaattgtgtgagctcta |
18913666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 169 - 218
Target Start/End: Complemental strand, 23464049 - 23464000
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| | |||||||||| |
|
|
| T |
23464049 |
tattatatgcaggggccggggttcgaaccccggacaccccacttgttcac |
23464000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 42946532 - 42946495
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42946532 |
catattatatgcaggggctggggtttgaaccccggaca |
42946495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 47088846 - 47088879
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47088846 |
ttatatgcaggggctggggttcgaaccccggaca |
47088879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 50899562 - 50899510
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
50899562 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggaca |
50899510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 27642778 - 27642692
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| |||| |||||||||| ||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
27642778 |
ttggtagggatattg-cattttatatgcaggg-ctggagttcgaaccctggacactccacttctccacaattaaattgtgtgagctcta |
27642692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 33218922 - 33218862
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||| | |||| | |||||||||||||||| |
|
|
| T |
33218922 |
ttatatgtagggggtggggttcgaaccccggacacttcacttctccacaatttaattgtgt |
33218862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 205
Target Start/End: Complemental strand, 52833169 - 52833133
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacat |
205 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52833169 |
tattatatgcaggggccggggttcgaaccccggacat |
52833133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 4553583 - 4553508
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||||||||| |||||||| | |||||| |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
4553583 |
catattatatgcaggggctgaggttcgaatctcggacacctcacttctccacaattaaattgtgtgagctctaacc |
4553508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 187 - 242
Target Start/End: Original strand, 10478193 - 10478248
Alignment:
| Q |
187 |
gggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||| ||||||| |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
10478193 |
gggttcgaaccccagacattccacttctgcacaattaaattgtgtgagctctaacc |
10478248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 12404374 - 12404455
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||| ||| | |||| | ||||||| |||||| |||| |
|
|
| T |
12404374 |
ttggtagggatattg-catattatatgcaggg-ctggggttcgaaccccgaacaccccacttctccacaattaaattgtatgag |
12404455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 171 - 202
Target Start/End: Original strand, 13763798 - 13763829
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccgga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13763798 |
ttatatgcaggggctggggttcgaaccccgga |
13763829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 15368837 - 15368872
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15368837 |
tattatatgcaggggccggggttcgaaccccggaca |
15368872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 17350093 - 17350128
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17350093 |
tattatatgcaggggccggggttcgaaccccggaca |
17350128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 18893288 - 18893225
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||| ||| |||||||||| |||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
18893288 |
ttatatgcagaggccggggttcgaatcccggacactccacttctccacaattaaattgtgtgag |
18893225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 230
Target Start/End: Complemental strand, 27784093 - 27784030
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtg |
230 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||| || |||| | ||||||| ||||||| |
|
|
| T |
27784093 |
catattatatgcaggggctgtgattcgaaccctggacactccacttctccacaattaaattgtg |
27784030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 42831979 - 42832014
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42831979 |
tattatatgcaggggctggggttcaaaccccggaca |
42832014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 171 - 242
Target Start/End: Original strand, 44019313 - 44019384
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||| ||| ||| |||||| |||||||| || |||| | ||||||||||||||||||| ||||||| |
|
|
| T |
44019313 |
ttatatgcaagggtcgggattcgaatcccggacactccacttctccacaatttaattgtgtgagctctaacc |
44019384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 173 - 204
Target Start/End: Complemental strand, 46116233 - 46116202
Alignment:
| Q |
173 |
atatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46116233 |
atatgcaggggctggggttcgaaccccggaca |
46116202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 5190818 - 5190732
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||| | |||| | ||||||| ||||||| ||||||| || ||| |||||| |
|
|
| T |
5190818 |
catattatatgcaggggtcgaggttcgaaccccggacaccccacttctccacaattatattgtgtaagttctagccactaggctact |
5190732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 12374550 - 12374465
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||| ||| ||||||||||||| ||||| | |||| ||||||||| ||||||||||| |||| | |||||||||| |
|
|
| T |
12374550 |
catattatatgcaagggtcggggttcgaaccc-ggacaccccacttcttcacaattaaattgtgtgagctctagtcactatgctact |
12374465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 253
Target Start/End: Original strand, 28344912 - 28344994
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||| | |||| | ||||||| |||| ||||||||||| || ||| |||||| |
|
|
| T |
28344912 |
ttatatgtaggggtcggggatcgaaccccggacatcccacttctccacaattaaattatgtgagttctagccactaggctact |
28344994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 234
Target Start/End: Complemental strand, 40211561 - 40211495
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
40211561 |
atattatatgcaggagtcggggttcgaaccccggacacttcacttctccacaattaaattgtgtgag |
40211495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 46021928 - 46021879
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
46021928 |
gtagggatattg-catattatatgcaggagccggggttcgaaccccggaca |
46021879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 7906387 - 7906354
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
7906387 |
ttatatgcaggggctggggttcgaacccgggaca |
7906354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 168 - 229
Target Start/End: Original strand, 10851858 - 10851919
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgt |
229 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || | || |||| | |||||||||||||| |
|
|
| T |
10851858 |
atattatatgcaggggacggggttcgaaccccagaaactccacttctccacaatttaattgt |
10851919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 18512608 - 18512575
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
18512608 |
ttatatgcaggggccggggttcgaaccccggaca |
18512575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 19424076 - 19424113
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19424076 |
catattatatgcaggggtcggggttcgaaccccggaca |
19424113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 19924483 - 19924536
Alignment:
| Q |
186 |
ggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||||| || |||| | || |||| |||||||||||||||| |
|
|
| T |
19924483 |
ggggttcgaaccccggacactccacttctccataattaaattgtgtgagttcta |
19924536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 19976613 - 19976580
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
19976613 |
ttatatgcaggggccggggttcgaaccccggaca |
19976580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 198
Target Start/End: Original strand, 20357492 - 20357521
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20357492 |
tattatatgcaggggctggggttcgaaccc |
20357521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 198
Target Start/End: Complemental strand, 20562463 - 20562434
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20562463 |
tattatatgcaggggctggggttcgaaccc |
20562434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 35068720 - 35068757
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
35068720 |
catattatatggaggggccggggttcgaaccccggaca |
35068757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 174 - 239
Target Start/End: Complemental strand, 36666606 - 36666542
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | |||| | ||||| ||||||||||||| |||| |
|
|
| T |
36666606 |
tatgcaggggccggggttcgaaccccggacaccccacttctccacaa-ttaattgtgtgagctcta |
36666542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 37662609 - 37662557
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
37662609 |
ttggtagggatattg-catattatatgcaggggtcggggtacgaaccccggaca |
37662557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 42367745 - 42367782
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
42367745 |
catattatatgcaggggccggggttcgaatcccggaca |
42367782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 50199537 - 50199504
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
50199537 |
ttatatgcaggggccggggttcgaaccccggaca |
50199504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 2352602 - 2352530
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| || |||||||||| |||| ||| || |||| | ||||||| |||||||||| |||| |
|
|
| T |
2352602 |
catattatatgcaggagccggggttcgaatcccgaacactccacttctccacaattatattgtgtgagctcta |
2352530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 217
Target Start/End: Complemental strand, 4429545 - 4429497
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttca |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| |||| |||| |
|
|
| T |
4429545 |
tattatatgcaggggttggggttcgaaccctgaacattccacttattca |
4429497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 6213439 - 6213526
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||| |||||| ||||| ||| |||||| | | |||| ||||||||| |||||||||||||||| |
|
|
| T |
6213439 |
ttggtagggatattg-catattatatacaggggtcagggtttgaatcccggataccccacttcttcacaattaaattgtgtgagttcta |
6213526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 204
Target Start/End: Complemental strand, 10699223 - 10699183
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| |||||||| |
|
|
| T |
10699223 |
ttacatattatatgtaggggccggggttcgaatcccggaca |
10699183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 10790557 - 10790521
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
10790557 |
atattatatgcaggggttggggtttgaaccccggaca |
10790521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 12662721 - 12662792
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||| || ||||||| | |||||| || |||| | ||| ||||||||||||||||||| |
|
|
| T |
12662721 |
catattatatgcaggggccggagttcgaaactcggacactc-acttctctacattttaattgtgtgagttcta |
12662792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 23369090 - 23369054
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
23369090 |
atattatatgcaggggccgcggttcgaaccccggaca |
23369054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 199
Target Start/End: Original strand, 24333582 - 24333629
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaacccc |
199 |
Q |
| |
|
|||||| ||||||| | |||||||||||||||||||| ||||||||||| |
|
|
| T |
24333582 |
ttggtatggatattaa-atattatatgcaggggctggagttcgaacccc |
24333629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 204
Target Start/End: Original strand, 32635175 - 32635207
Alignment:
| Q |
172 |
tatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
32635175 |
tatatgcaggggttggggttcgaaccccggaca |
32635207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 204
Target Start/End: Original strand, 32660865 - 32660897
Alignment:
| Q |
172 |
tatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
32660865 |
tatatgcaggggctggggttcaaaccccggaca |
32660897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 35605675 - 35605588
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||| ||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
35605675 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaaccctaaacaccccacttctccacaattaaattgtgtgagctcta |
35605588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 242
Target Start/End: Complemental strand, 39670859 - 39670792
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||| |||||||||||| || ||||| | |||| | ||| ||||||||||||||| ||||||| |
|
|
| T |
39670859 |
tatgcaggggttggggttcgaactccagacatcccacttctccac-atttaattgtgtgagctctaacc |
39670792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 200
Target Start/End: Complemental strand, 39922137 - 39922101
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccg |
200 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| |
|
|
| T |
39922137 |
ttacatattatatgcaggggttagggttcgaaccccg |
39922101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 51933524 - 51933611
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||| || ||||||| | || | ||||||| ||||||||||| |||| |
|
|
| T |
51933524 |
ttggtagggatattg-catattatatgcaggaatcggggttcgaactccagacattccatttctccacaattaaattgtgtgaggtcta |
51933611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 52369615 - 52369702
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || | ||||||||||| ||| | || |||| | || |||| ||||||||||| |||| |
|
|
| T |
52369615 |
ttggtagggatattg-catattatatgcaggagccgaggttcgaaccctggatactccacttctccataattaaattgtgtgagctcta |
52369702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 203
Target Start/End: Complemental strand, 52961143 - 52961111
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggac |
203 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
52961143 |
ttatatgcaggggccggggttcgaaccccggac |
52961111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 7e-24; HSPs: 146)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 19999885 - 19999972
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||| || | |||||||||||||||||||||||| |
|
|
| T |
19999885 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagacactctagttctccacaatttaattgtgtgagttcta |
19999972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 882407 - 882508
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||| | ||| || |||| | ||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
882407 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccctgaacactccacttttccacaatttaattgtgtgagttctaaccactaggct |
882505 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
882506 |
act |
882508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 17608371 - 17608270
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||| ||||| || |||| | |||||||||||||||||||||||| || ||| ||| |
|
|
| T |
17608371 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggct |
17608273 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
17608272 |
act |
17608270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 22501983 - 22501882
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
22501983 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggct |
22501885 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
22501884 |
act |
22501882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 13638297 - 13638215
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||| |||| || |||| | ||||||||||||||||||| |
|
|
| T |
13638297 |
ttggtagggatatt-acatattatatgtaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgag |
13638215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 6488142 - 6488243
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||| |||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
6488142 |
ttggtagggatattg-catattatatgcaggggctagggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggct |
6488240 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
6488241 |
act |
6488243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 10176955 - 10176854
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||||||| |
|
|
| T |
10176955 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactatgct |
10176857 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
10176856 |
act |
10176854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 15975170 - 15975271
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||||| |||||| || |||| ||||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
15975170 |
ttggtagggatattg-catattatatgcaggagccggggttcgaacctcggacactccacttcttcacaattaaattgtgtgagctctaaccactaggct |
15975268 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
15975269 |
act |
15975271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 53347342 - 53347260
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||| |||| || |||| | ||||||||||||||||||| |
|
|
| T |
53347342 |
ttggtagggatattg-catattatatgcagggactggggttcgaaccccagacactccacttctccacaatttaattgtgtgag |
53347260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 3748654 - 3748553
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
3748654 |
ttggtagggatattgt-atattatatgcaggggttggggttcgaaccccggacatctcacttctccacaatttaattgtgtgagctctagccactaggct |
3748556 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
3748555 |
act |
3748553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 4139018 - 4139119
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
4139018 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
4139116 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
4139117 |
act |
4139119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 4640532 - 4640431
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| || ||| || |||| ||||||||| ||||||||||| ||||| | ||| ||| |
|
|
| T |
4640532 |
ttggtagggatattg-catattatatgcaggagctggggttcgaacctcgaacactccacttcttcacaattaaattgtgtgagctctaatcactaggct |
4640434 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
4640433 |
act |
4640431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 7269973 - 7270074
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| ||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
7269973 |
ttggtagggatattg-catattatatgcaggagctggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
7270071 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
7270072 |
act |
7270074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 10482905 - 10482804
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| ||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
10482905 |
ttggtagggatattg-catattatatgcaggagctggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
10482807 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
10482806 |
act |
10482804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 17218506 - 17218607
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| ||||||| ||||||||||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
17218506 |
ttggtagggatattg-catattatatgcaagggccggggttcaaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggct |
17218604 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
17218605 |
act |
17218607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 18194356 - 18194457
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
18194356 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
18194454 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
18194455 |
act |
18194457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 30779619 - 30779518
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||| ||||| | |||| | |||||||||||||||||||||||| || ||| ||| |
|
|
| T |
30779619 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaaccctggacaccccacttctccacaatttaattgtgtgagttctagccactaggct |
30779521 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
30779520 |
act |
30779518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 33706779 - 33706678
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||| | || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
33706779 |
ttggtagggatatt-acatattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
33706681 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
33706680 |
act |
33706678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 37800663 - 37800562
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
37800663 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
37800565 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
37800564 |
act |
37800562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 39719953 - 39720054
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
39719953 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
39720051 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
39720052 |
act |
39720054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 40933883 - 40933782
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
40933883 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
40933785 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
40933784 |
act |
40933782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 41936459 - 41936358
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
41936459 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
41936361 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
41936360 |
act |
41936358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 47098750 - 47098851
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
47098750 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccactaagct |
47098848 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
47098849 |
act |
47098851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 50496866 - 50496765
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
50496866 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
50496768 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
50496767 |
act |
50496765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 53432789 - 53432688
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
53432789 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
53432691 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
53432690 |
act |
53432688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 53752737 - 53752651
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| || |||||||||| ||||| || |||| | |||||||||||||||||||||||| || ||| |||||| |
|
|
| T |
53752737 |
catattatatgcaggggcaggagttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggctact |
53752651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 152 - 253
Target Start/End: Original strand, 19879220 - 19879320
Alignment:
| Q |
152 |
tggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgcta |
251 |
Q |
| |
|
||||||||||| | |||| |||||||||||||| ||||||||||||||| ||| | |||| ||||||||| ||||||||||| |||| || |||||||| |
|
|
| T |
19879220 |
tggtagggatact-acattttatatgcaggggccggggttcgaaccccgaacaccccacttcttcacaattaaattgtgtgagctctagccactatgcta |
19879318 |
T |
 |
| Q |
252 |
ct |
253 |
Q |
| |
|
|| |
|
|
| T |
19879319 |
ct |
19879320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 151 - 248
Target Start/End: Complemental strand, 31327770 - 31327674
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatg |
248 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||||| |
|
|
| T |
31327770 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactatg |
31327674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 151 - 252
Target Start/End: Original strand, 50234142 - 50234242
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
50234142 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
50234240 |
T |
 |
| Q |
251 |
ac |
252 |
Q |
| |
|
|| |
|
|
| T |
50234241 |
ac |
50234242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 19996504 - 19996417
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
19996504 |
ttggtagggatattg-catattatatgcaggagttggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
19996417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 52974105 - 52974018
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
52974105 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
52974018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 11436522 - 11436612
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||||||||||| ||||| | |||| | ||||||| ||||||||||||||||||| |
|
|
| T |
11436522 |
ttggtagggatattg-catattatatgcaggggccgtggttcgaaccctggacaccccacttctccacaattaaattgtgtgagttctaacc |
11436612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 28689724 - 28689642
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || |||| | ||||||||||||||||||| |
|
|
| T |
28689724 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaatttaattgtgtgag |
28689642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 2522944 - 2523045
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||| | ||||||||| |||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
2522944 |
ttggtagggatattg-catattatatgcaagagctggggtttgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
2523042 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
2523043 |
act |
2523045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 6920015 - 6919914
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||| ||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
6920015 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctagccactaggct |
6919917 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
6919916 |
act |
6919914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 7920338 - 7920439
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||| | || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
7920338 |
ttggtagggatattg-catattatatgcaagagccggggttcgaaccccggacactcaacttctccacaattaaattgtgtgagctctagccactaggct |
7920436 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
7920437 |
act |
7920439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 25938982 - 25938881
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||| || |||| | || ||||||| |||||||| |||| || ||| ||| |
|
|
| T |
25938982 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccacacactccacttctccataatttaactgtgtgagctctagccactaggct |
25938884 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
25938883 |
act |
25938881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 31327553 - 31327452
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||| | || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
31327553 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggaaactccacttctccacaattaaattgtgtgagctctagccactaggct |
31327455 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
31327454 |
act |
31327452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 33606991 - 33606891
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| | |||||||||||||||||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
33606991 |
ttggtagggatattg-cattttatatgcagggg-tcgggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggct |
33606894 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
33606893 |
act |
33606891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 37488493 - 37488411
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
37488493 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
37488411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 39966126 - 39966025
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || |||||||||| | |||| || |||| | ||||||||||||||||||| |||| || |||||| |
|
|
| T |
39966126 |
ttggtagggatattg-catattatatgcaggggttgaggttcgaacctcagacactccacttctccacaatttaattgtgtgagctctagccattatgct |
39966028 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
39966027 |
act |
39966025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 40548321 - 40548422
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || | || | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
40548321 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggct |
40548419 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
40548420 |
act |
40548422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 45701362 - 45701463
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||| | || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
45701362 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactaggct |
45701460 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
45701461 |
act |
45701463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 49447156 - 49447237
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| |||||||||| |
|
|
| T |
49447156 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtga |
49447237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 50659608 - 50659709
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||||||||||||||| || |||| | |||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
50659608 |
ttggtagggatatc-acattttatatgcaggggccggggttcgaaccccggacactccacttctcgacaattaaattgtgtgagctctagccactaagct |
50659706 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
50659707 |
act |
50659709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 154 - 219
Target Start/End: Original strand, 23939055 - 23939119
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcaca |
219 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| ||||||| |||||| |
|
|
| T |
23939055 |
gtagggatatt-acatattatatgcagaggttggggttcgaaccccggacactctacttcttcaca |
23939119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 5636851 - 5636764
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||| ||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
5636851 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccctggacactcgacttctccacaattaaattgtgtgagctcta |
5636764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 9176638 - 9176551
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||| | || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
9176638 |
ttggtagggatattg-catattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
9176551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 19550524 - 19550611
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| | |||||||||||| ||| || |||| | ||||||| |||||||||||||||| |
|
|
| T |
19550524 |
ttggtagggatattg-catattatatgcaggagcttgtgttcgaaccccgtacactccacttctccacaattaaattgtgtgagttcta |
19550611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 32256606 - 32256519
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
32256606 |
ttggtagggatattg-catgttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
32256519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 34102663 - 34102576
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| || |||||||| |||| |
|
|
| T |
34102663 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaactgtgtgagctcta |
34102576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 34898819 - 34898732
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||| |||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
34898819 |
ttggtagggatattg-catattatatgcaggggctgaggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctcta |
34898732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 38819375 - 38819289
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||| |||||| ||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
38819375 |
ttggtagggatattt-catattatatgcagggactggggttctaacccc-aacactccacttctccacaatttaattgtgtgagctcta |
38819289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 45198741 - 45198828
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| |||||||||| | |||| ||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
45198741 |
ttggtagggatattg-catattatatgtaggggctgaggttcgaacctcagacactctacttctccacaattaaattgtgtgagctcta |
45198828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 8125657 - 8125739
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | |||||||||| ||||||| ||||||| | || |||||||||||||||| |
|
|
| T |
8125657 |
ttggtagggatattg-catattatatgcagggaccggggttcgaattccggacactctacttctccaaaatttaattgtgtgag |
8125739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 4541916 - 4541996
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||| |||| || |||| | |||||||||||||||||| |
|
|
| T |
4541916 |
ttggtagggatattgt-atattatatgcaggggctggggttcg-accccagacactccacttctccacaatttaattgtgtga |
4541996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 5641651 - 5641565
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||| |||| ||||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
5641651 |
catattatatgcaggggccggggttcgaacctcggacacctcacttcttcacaattaaattgtgtgagctctagccactaagctact |
5641565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 49194729 - 49194643
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||| | |||| | ||||||||||||||||||| |||| || |||||||||| |
|
|
| T |
49194729 |
catattatatgtaggggtcagggttcgaaccccggacacttcacttctccacaatttaattgtgtgagctctagccactatgctact |
49194643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 53163612 - 53163713
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| ||||||||||||||||||| | |||| | | ||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
53163612 |
ttggtagggatattg-catattatatgtaggggccggggttcgaaccccggacaccccacttctccgcaattaaattgtgtgagctctagccactaggct |
53163710 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
53163711 |
act |
53163713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 252
Target Start/End: Original strand, 53577988 - 53578073
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctac |
252 |
Q |
| |
|
||||||||||||| | || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||||| |
|
|
| T |
53577988 |
catattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctac |
53578073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 2390391 - 2390319
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| || | || | ||||||| ||||||||||| |||| |
|
|
| T |
2390391 |
catattatatgcaggagctagggttcgaaccccggacactcaatttctccacaattaaattgtgtgagctcta |
2390319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 3894577 - 3894649
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
3894577 |
catattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaattgtgtgagctcta |
3894649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 17602728 - 17602641
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| | ||||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
17602728 |
ttggtagggatattg-catattatatgtaggggccgaggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
17602641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 17729024 - 17729096
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
17729024 |
catattatatgcaggggtcggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctcta |
17729096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 19030253 - 19030325
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
19030253 |
catattatatgcaggggtcggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctcta |
19030325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 31529010 - 31528923
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| | |||||||||||||| | ||||||||||||||||||| || |||| | ||||||| |||||| |||| |||| |
|
|
| T |
31529010 |
ttggtagggatattga-atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtatgagctcta |
31528923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 40963744 - 40963676
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| || ||| | ||||||||||||||||||| |||| |
|
|
| T |
40963744 |
ttatatgcaggggtcggggttcgaaccccggacaatcctcttctccacaatttaattgtgtgagctcta |
40963676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 251
Target Start/End: Complemental strand, 42108234 - 42108135
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| ||| |||||||||||||| | |||| | ||||||| ||||||||||||||| ||| ||| ||| |
|
|
| T |
42108234 |
ttggtagggatattg-catattatatgcagaggccgggtttcgaaccccggacgccccacttctccacaattaaattgtgtgagttcttaccactaggct |
42108136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 48739796 - 48739709
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||| |||| | |||| | ||||||| || |||||||| |||| |
|
|
| T |
48739796 |
ttggtagggatattg-cattttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaactgtgtgagctcta |
48739709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 52410293 - 52410206
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||| |||||||||| |||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
52410293 |
ttggtagggatattg-catattatatgcaggagccgggattcgaaccccagacactccacttctccacaattaaattgtgtgagctcta |
52410206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 251
Target Start/End: Complemental strand, 52434719 - 52434620
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||| ||| || ||||||||||||||||||| || |||| | |||||||||||| ||||| ||||||| ||| ||| |
|
|
| T |
52434719 |
ttggtagggatattg-catattatatacagaggacggggttcgaaccccggacactccacttctcaacaatttaattgagtgagctctaaccactaggct |
52434621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 242
Target Start/End: Original strand, 4860198 - 4860269
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| | |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
4860198 |
ttatatgcaggggctgaggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctaacc |
4860269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 239
Target Start/End: Original strand, 14887260 - 14887335
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| | ||| || |||| | |||||||||||||| |||| |||| |
|
|
| T |
14887260 |
ttacatattatatgcaggggtcggggttcgaaccctgtacactccacttctccacaatttaattgtatgagctcta |
14887335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 33206789 - 33206824
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33206789 |
tattatatgcaggggctggggttcgaaccccggaca |
33206824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 42920680 - 42920617
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||| || |||| | ||||||| ||||||||||| |
|
|
| T |
42920680 |
ttatatgcaggggttggggttcgaaccccagacactccacttctccacaattaaattgtgtgag |
42920617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 52945913 - 52946002
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||| |||| ||| || |||| | |||||||||||||| |||| ||||||| |
|
|
| T |
52945913 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaa-cccgtacactccacttctccacaatttaattgtatgagctctaacc |
52946002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 2007120 - 2007034
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| | |||||| |||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
2007120 |
catattatatgcaggagtcggggtttgaaccccggacactccacttctccacaattaaattgtgtgagctctatccactaggctact |
2007034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 2368969 - 2369011
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattcta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
2368969 |
catattatatgcaggggctggggttcgaaccccagacactcta |
2369011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 233
Target Start/End: Complemental strand, 4200637 - 4200556
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||| |||| || | || | ||||||| |||||||||| |
|
|
| T |
4200637 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaaccccagacactcaatttctccacaattaaattgtgtga |
4200556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 8964828 - 8964727
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| || ||||||||||| ||| ||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
8964828 |
ttggtagggatattg-catatcatatgcaggagccggggttcgaactccgaacactccacttctccacaattaaattgtgtgagctctagccactaggct |
8964730 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
8964729 |
act |
8964727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 30555279 - 30555178
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||| ||||| | || |||| |||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
30555279 |
ttggtagggatattg-catattaaatgcaagagcaggggatcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
30555181 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
30555180 |
act |
30555178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 33225381 - 33225299
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| || |||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
33225381 |
ttatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccactaagctact |
33225299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 42268802 - 42268903
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||| ||| |||||||| || |||| | |||||||||||||| ||| ||||||| ||| ||| |
|
|
| T |
42268802 |
ttggtagggatattg-catattatatgcaggggccagagtttgaatcccggacactccacttctccacaatttaattgtacgagctctaaccactaggct |
42268900 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
42268901 |
act |
42268903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 48251605 - 48251691
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || |||||| |||||| ||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
48251605 |
catattatatgcaggagccggggttagaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
48251691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 48722277 - 48722363
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||| || | |||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
48722277 |
catattatatgcaggggtcggggttcgaaccccggacaccctatttctctacaattaaattgtgtgagctctagccactaagctact |
48722363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 171 - 253
Target Start/End: Original strand, 53906416 - 53906498
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
53906416 |
ttatatgcaggggccggggtttgaaccccggacacttcacttttccacaattaaattgtgtgagctctagccactaggctact |
53906498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 34102103 - 34102136
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34102103 |
ttatatgcaggggctggggttcgaaccccggaca |
34102136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 171 - 252
Target Start/End: Complemental strand, 45551842 - 45551761
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctac |
252 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||||| |
|
|
| T |
45551842 |
ttatatgtaggggccgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctac |
45551761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 168 - 241
Target Start/End: Complemental strand, 51155128 - 51155055
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
|||||||||| ||||||||||||||||||| | |||| | |||| | ||||||| ||||||||||| |||||| |
|
|
| T |
51155128 |
atattatatgtaggggctggggttcgaacctccgacaccccacttctccacaattaaattgtgtgagctctaac |
51155055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 169 - 218
Target Start/End: Original strand, 52030153 - 52030202
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||| ||||| |
|
|
| T |
52030153 |
tattatatgcaggggccggggttcgaaccccggacaccctacttattcac |
52030202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 11234479 - 11234547
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||| || |||| | ||||| | ||||||||||| |||| |
|
|
| T |
11234479 |
ttatatgcaggagctggggttcgaaccccagacaatccacttctccacaaataaattgtgtgagctcta |
11234547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 22472351 - 22472279
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| | || ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
22472351 |
catattatatgcaagagccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
22472279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 23954877 - 23954949
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||| || ||||| ||||||||||||| |||| | ||| ||| ||||||||||| |||| |
|
|
| T |
23954877 |
catattatatgcaggggttgaggttcaaaccccggacattgcacttttccactattaaattgtgtgagctcta |
23954949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 31586965 - 31587052
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || ||||||| |||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
31586965 |
ttggtagggatattg-catattatatgcaggggtcggagttcgaatcccggacaccccacttctccacaattaaattgtgtgagctcta |
31587052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 32144617 - 32144689
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| | | || | ||||||| ||||||||||| |||| |
|
|
| T |
32144617 |
catattatatgcaggagccggggttcgaaccccggacaccccatttctccacaattaaattgtgtgagctcta |
32144689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 32828459 - 32828546
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| |||| ||| ||| |||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
32828459 |
ttggtagggatattg-catattatatgcaggagctgaggtttgaatcccagacactccacttttccacaattaaattgtgtgagctcta |
32828546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 36625223 - 36625136
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||||||||| ||| ||| || |||| || ||| || ||||||||||| |||| |
|
|
| T |
36625223 |
ttggtagggatattg-catattatatgcaggagttggggttcgaactccgaacactccacttctttacagttaaattgtgtgagctcta |
36625136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 39300402 - 39300487
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||| ||||||||||||||||| |||| || | || ||||||||| ||||||||||| |||| |
|
|
| T |
39300402 |
ttggtagggatatt-acattttata-gcaggagctggggttcgaacccc-gacactccatttcttcacaattaaattgtgtgagctcta |
39300487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 40192174 - 40192260
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||| || || ||||||| |||||||| || |||| | |||| ||||||||||||||||||| |
|
|
| T |
40192174 |
ttggtagggatattg-catattatatgcagaggtcggtgttcgaatcccggacactccacttctccaca-tttaattgtgtgagttcta |
40192260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 40910217 - 40910145
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||| || |||| | ||||||| |||||||||| |||| |
|
|
| T |
40910217 |
catattatatgcaggggctgaggtccgaaccccagacactccacttctccacaattatattgtgtgagctcta |
40910145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 46795981 - 46795894
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| ||||||||||||| | ||| || | || | ||||||| ||||||||||| |||| |
|
|
| T |
46795981 |
ttggtagggatattg-cattttatatgcaggggccggggttcgaaccctgaacactccatttctccacaattaaattgtgtgagctcta |
46795894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 49375733 - 49375647
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||| ||| ||||| | |||||||||||||| |||||||||||||||| || |||| ||| |||||||| ||||||||||| |
|
|
| T |
49375733 |
ttggtagggacatt-acataatttatgcaggggctggcgttcgaaccccggacactccacttcaccac-atttaattatgtgagttcta |
49375647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 51425858 - 51425945
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||||||||| ||||| | |||| | |||||| ||||||||||| |||| |
|
|
| T |
51425858 |
ttggtagggatatc-acattttatatgcaggggccggggttcgaaccctggacacttcacttctcgacaattaaattgtgtgagctcta |
51425945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 52984028 - 52984115
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||| |||||| ||| ||||||||||||||||||| || |||| | |||||| ||||||||||| |||| |
|
|
| T |
52984028 |
ttggtagggatattg-catattgtatgcaagggtcggggttcgaaccccggacactccacttctctacaattaaattgtgtgagctcta |
52984115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 171 - 242
Target Start/End: Original strand, 4880206 - 4880277
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||| | |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
4880206 |
ttatatgcagtggctgaggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctaacc |
4880277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 8762132 - 8762050
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | |||||||||||| ||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
8762132 |
ttggtagggatatt-acatattatatgcaggtgtcggggttcgaaccatggacaccccacttctccacaattaaattgtgtgag |
8762050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 9625015 - 9625050
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9625015 |
tattatatgcaggggccggggttcgaaccccggaca |
9625050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 14417900 - 14417935
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14417900 |
tattatatgcaggggctggagttcgaaccccggaca |
14417935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 24751323 - 24751288
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24751323 |
tattatatgcaggggccggggttcgaaccccggaca |
24751288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 27183744 - 27183709
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27183744 |
tattatatgcaggggccggggttcgaaccccggaca |
27183709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 29373486 - 29373419
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||| | |||| | ||||||| ||||||||||| |
|
|
| T |
29373486 |
catattatatgcaggggccggggttcgaacctcagacaccccacttctccacaattaaattgtgtgag |
29373419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 210
Target Start/End: Original strand, 45871035 - 45871093
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctac |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
45871035 |
ttggtagggatattgt-atattatatgcaggggtcggggttcgaaccccggacactctac |
45871093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 19591616 - 19591530
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| ||| || ||||||||||||||||||| || |||| | || |||| ||||||| ||| |||| || ||| |||||| |
|
|
| T |
19591616 |
catattatatgtaggagccggggttcgaaccccggacactccacttctccataattaaattgtgagagctctagccactaggctact |
19591530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 46006469 - 46006431
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacat |
205 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
46006469 |
catattatatgcagggggtggggttcgaactccggacat |
46006431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 50675794 - 50675693
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||| |||||| || ||||||||| | ||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
50675794 |
ttggtagggatattg-catattatatacaggggttgtggttcgaactctggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
50675696 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
50675695 |
act |
50675693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 14271992 - 14271955
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| |
|
|
| T |
14271992 |
catattatatgcaggggccggagttcgaaccccggaca |
14271955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 15491886 - 15491923
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
15491886 |
catattatatgcaggggttggggttcgaaccccagaca |
15491923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 202
Target Start/End: Original strand, 20244166 - 20244199
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccgga |
202 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
20244166 |
tattatatgcaggggccggggttcgaaccccgga |
20244199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 20489848 - 20489885
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| |
|
|
| T |
20489848 |
catattatatgcaggggccggagttcgaaccccggaca |
20489885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 174 - 239
Target Start/End: Original strand, 24303430 - 24303494
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | |||| | ||| ||||||||||||||| |||| |
|
|
| T |
24303430 |
tatgcaggggccggggttcgaaccccggacaccccacttctccac-atttaattgtgtgagctcta |
24303494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 24537861 - 24537894
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
24537861 |
ttatatgcaggggccggggttcgaaccccggaca |
24537894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 27329965 - 27329932
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
27329965 |
ttatatgcaggggccggggttcgaaccccggaca |
27329932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 27394541 - 27394574
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
27394541 |
ttatatgcaggggctggggtttgaaccccggaca |
27394574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 174 - 239
Target Start/End: Original strand, 32776251 - 32776316
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| | | ||||||||||||||||| |||| |
|
|
| T |
32776251 |
tatgcaggggccggggttcgaaccccggacacctcacttctccccaatttaattgtgtgagctcta |
32776316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 34847561 - 34847613
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
34847561 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaactccggaca |
34847613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 173 - 202
Target Start/End: Complemental strand, 36408057 - 36408028
Alignment:
| Q |
173 |
atatgcaggggctggggttcgaaccccgga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36408057 |
atatgcaggggctggggttcgaaccccgga |
36408028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 150 - 199
Target Start/End: Complemental strand, 39084213 - 39084165
Alignment:
| Q |
150 |
tttggtagggatatttacatattatatgcaggggctggggttcgaacccc |
199 |
Q |
| |
|
|||| |||||||||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
39084213 |
tttgttagggatatt-acattttatatgcgggggctggggttcgaacccc |
39084165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 44625258 - 44625225
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
44625258 |
ttatatgcaggggccggggttcgaaccccggaca |
44625225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 46328985 - 46328952
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
46328985 |
ttatatgcaggggccggggttcgaaccccggaca |
46328952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 200
Target Start/End: Complemental strand, 46336555 - 46336506
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccg |
200 |
Q |
| |
|
|||||||||||| |||||| |||||||||||| ||||||||||||||| |
|
|
| T |
46336555 |
ttggtagggataaatacataatatatgcaggggtcggggttcgaaccccg |
46336506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 174 - 231
Target Start/End: Complemental strand, 49983738 - 49983682
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| | ||||| |||||||||| |
|
|
| T |
49983738 |
tatgcaggggttggggttcgaaccccggacaccctacttctccacaa-ttaattgtgt |
49983682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 51879132 - 51879165
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
51879132 |
ttatatgcaggggccggggttcgaaccccggaca |
51879165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 253
Target Start/End: Original strand, 10349439 - 10349519
Alignment:
| Q |
173 |
atatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||| | ||| |||||||| |||||| || |||| | ||||||| ||||||||||| ||||||| ||| |||||| |
|
|
| T |
10349439 |
atatgcaggagtcgggtttcgaacctcggacactccacttctccacaattaaattgtgtgagctctaaccactaggctact |
10349519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 11820022 - 11820109
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||||| ||| | ||||||||||||||||| | || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
11820022 |
ttggtagggatattg-catgttatatgtaggagtcggggttcgaaccccggaaactccacttctccacaattaaattgtgtgagctcta |
11820109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 217
Target Start/End: Original strand, 15498238 - 15498286
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttca |
217 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||||||| |||| |||| |
|
|
| T |
15498238 |
tattatatgtaggggccggagttcgaaccccggacattccacttattca |
15498286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 17472367 - 17472295
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| |||||| |||||||| |||| | || | || | ||||||| ||||||||||| |||| |
|
|
| T |
17472367 |
catattatatgcaggagctgggattcgaacctcggatactccaattctccacaattaaattgtgtgagctcta |
17472295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 234
Target Start/End: Complemental strand, 19222616 - 19222557
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | |||| | ||| ||||||||||||||| |
|
|
| T |
19222616 |
tatgcaggggccggggttcgaaccccggacaccccacttctccac-atttaattgtgtgag |
19222557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 25279111 - 25279024
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||| |||||| ||| || |||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
25279111 |
ttggtagggatattgt-atattatatgtaggggccgggatttgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
25279024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 25833856 - 25833927
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| || |||||||||||| || ||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
25833856 |
catattatatgcaggagc-ggggttcgaacctcgaacactccacttatccacaattaaattgtgtgagctcta |
25833927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 25954831 - 25954759
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||| | | || | ||||||| ||||||||||||||| |
|
|
| T |
25954831 |
catattatatgcaggggccgaggttcgaacctcggacaccccatttctccacaattatattgtgtgagttcta |
25954759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 26942771 - 26942858
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| | |||| | |||| | |||||| ||||||||||| |||| |
|
|
| T |
26942771 |
ttggtagggatattg-catattatatgcaggggccagggttcgaaccgcagacaccccacttctctacaattaaattgtgtgagctcta |
26942858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 204
Target Start/End: Original strand, 29098726 - 29098762
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29098726 |
atattatatgcaggggtcggggttcgaaccccggaca |
29098762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 198
Target Start/End: Complemental strand, 31108822 - 31108794
Alignment:
| Q |
170 |
attatatgcaggggctggggttcgaaccc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31108822 |
attatatgcaggggctggggttcgaaccc |
31108794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 195
Target Start/End: Complemental strand, 49750443 - 49750415
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49750443 |
catattatatgcaggggctggggttcgaa |
49750415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 203
Target Start/End: Original strand, 51467213 - 51467245
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggac |
203 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
51467213 |
ttatatgcaggggttggggttcgaaccccggac |
51467245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 54769882 - 54769796
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || || ||||||||| |||||| | |||| | ||| ||||||||||||||| |||| |
|
|
| T |
54769882 |
ttggtagggatattg-catattatatgcaggtgccggagttcgaaccacggacaccccacttctccac-atttaattgtgtgagctcta |
54769796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 118)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 19753020 - 19752919
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||| ||||| || |||| | |||||||||||||||||||||||| || ||| ||| |
|
|
| T |
19753020 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggct |
19752922 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
19752921 |
act |
19752919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 42548080 - 42547990
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||| ||||| |||| ||||||| ||||||||||||||||||| |||||| ||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
42548080 |
ttggtaggaatatt-acattttatatgtaggggctggggttcgaacctcggacactctacttctccacaattaaattgtgtgagttctaacc |
42547990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 3766829 - 3766930
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
3766829 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggct |
3766927 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
3766928 |
act |
3766930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 15238907 - 15239008
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| || |||| | || |||||||||||||||| |||| || ||| ||| |
|
|
| T |
15238907 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacactccacttctccataatttaattgtgtgagctctagccactaggct |
15239005 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
15239006 |
act |
15239008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 151 - 252
Target Start/End: Complemental strand, 23102610 - 23102510
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| |||||||||||||||| || ||| ||| |
|
|
| T |
23102610 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagttctagccactaggct |
23102512 |
T |
 |
| Q |
251 |
ac |
252 |
Q |
| |
|
|| |
|
|
| T |
23102511 |
ac |
23102510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 8174134 - 8174221
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||||||||||||||||| ||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
8174134 |
ttggtagggatattg-cattttatatgcaggagctggggttcgaaccccggacactctacttctccacaattaaattgtgtgagctcta |
8174221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 9877319 - 9877232
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| |||||||||||||||| |
|
|
| T |
9877319 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagttcta |
9877232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 32074447 - 32074360
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
32074447 |
ttggtagggatatc-acattttatatgcaggggctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
32074360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 1563791 - 1563690
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | |||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
1563791 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctctacaattaaattgtgtgagctctaaccactaggct |
1563693 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
1563692 |
act |
1563690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 25833573 - 25833674
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| || | || |||| | |||||||||||||||| || |||| || ||| ||| |
|
|
| T |
25833573 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaattgtgtaagctctagccactaggct |
25833671 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
25833672 |
act |
25833674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 26801766 - 26801680
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| || |||| ||||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
26801766 |
catattatatgcaggagccggggttcgaaccccggacactccacttcttcacaattaaattgtgtgagctctagccactaggctact |
26801680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 29617423 - 29617524
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
29617423 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
29617521 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
29617522 |
act |
29617524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 31026237 - 31026338
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
31026237 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
31026335 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
31026336 |
act |
31026338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 32676994 - 32676893
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
32676994 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaagct |
32676896 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
32676895 |
act |
32676893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 38889545 - 38889444
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||| ||||| |||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
38889545 |
ttggtagggatattg-catattatatgcaggggctgaggttcgtaccccagacactccacttctccacaatttaattgtgtgagctctatccactaggct |
38889447 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
38889446 |
act |
38889444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 48119488 - 48119589
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | ||||||||||||||||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
48119488 |
ttggtagggatattg-cattttatatgcaggggccgaggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggct |
48119586 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
48119587 |
act |
48119589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 30388559 - 30388472
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
30388559 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctcta |
30388472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 30806133 - 30806220
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || ||||||||||||||||| | |||| | ||||||| |||||||||||||||| |
|
|
| T |
30806133 |
ttggtagggatattg-catattatatgcaggggtcggagttcgaaccccggacatcccacttctccacaattaaattgtgtgagttcta |
30806220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 36174408 - 36174495
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
36174408 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttttccacaattaaattgtgtgagctcta |
36174495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 231
Target Start/End: Original strand, 47641063 - 47641142
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||| |||| || |||| | |||||||||||||||| |
|
|
| T |
47641063 |
ttggtagggatattg-catattatatgtaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgt |
47641142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 10675 - 10585
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || | ||||||| ||| ||| || |||| | ||||||||||||||||||||||||||| |
|
|
| T |
10675 |
ttggtagggatattg-catattatatgcaggggatgtgattcgaactccgaacactccacttctccacaatttaattgtgtgagttctaacc |
10585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 167 - 242
Target Start/End: Original strand, 14204305 - 14204380
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||| || |||| | ||||||||||||||||| | ||||||| |
|
|
| T |
14204305 |
catattatatgtaggggctggggttcgaacctcggacactccacttctccacaatttaattgtgtgggctctaacc |
14204380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 36469757 - 36469675
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||| ||||||| || ||||||||||||||||||| || |||| | || |||||||||||||||| |
|
|
| T |
36469757 |
ttggtagggatatt-acatattacatgcaggagccggggttcgaaccccggacactccacttctccataatttaattgtgtgag |
36469675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 12640641 - 12640540
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
12640641 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccactaggct |
12640543 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
12640542 |
act |
12640540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 13720803 - 13720889
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| || |||| | || |||||||||||||||| |||| || ||| |||||| |
|
|
| T |
13720803 |
catattatatgcaggggccggggttcgaaccccgaacactccacttctccaaaatttaattgtgtgagctctagccactaggctact |
13720889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 24508844 - 24508945
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| || || |||||||||||||||||||||| |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
24508844 |
ttggtagggatattg-catattatatgatggagccggggttcgaaccccggacattccacttctccacaattaaattgtgtgagctctagccactaggct |
24508942 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
24508943 |
act |
24508945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 24781048 - 24781149
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||| | || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
24781048 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactaggct |
24781146 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
24781147 |
act |
24781149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 35950146 - 35950247
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
35950146 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
35950244 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
35950245 |
act |
35950247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 48719832 - 48719918
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || |||||||||||||| |||| || |||| | ||||||||||||||||||| |||| || ||| |||||| |
|
|
| T |
48719832 |
catattatatgcaggagccggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctact |
48719918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 151 - 232
Target Start/End: Original strand, 15694568 - 15694647
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtg |
232 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || |||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
15694568 |
ttggtagggatattgt-atattatatgcaggggctgggttt-gaaccccggacactccacttcttcacaatttaattgtgtg |
15694647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 151 - 232
Target Start/End: Original strand, 15701548 - 15701627
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtg |
232 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || |||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
15701548 |
ttggtagggatattgt-atattatatgcaggggctgggttt-gaaccccggacactccacttcttcacaatttaattgtgtg |
15701627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 24880504 - 24880417
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| | |||||||||||||| || ||||||||||||||| ||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
24880504 |
ttggtagggatattga-atattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctcta |
24880417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 32856969 - 32856882
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||| |||| || |||| | |||||||||||| |||||| |||| |
|
|
| T |
32856969 |
ttggtagggatattg-catattatatgcaggggctgaagttcgaaccccagacactccacttctccacaatttaattatgtgagctcta |
32856882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 34267588 - 34267516
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
34267588 |
catattatatgcaggagctggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctcta |
34267516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 36391956 - 36391869
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
36391956 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
36391869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 9712250 - 9712168
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
9712250 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaaccccggacaccccacttctccacaattaaattgtgtgag |
9712168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 31769564 - 31769482
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||||||||||| |||| ||||||| | ||||||| ||||||||||| |
|
|
| T |
31769564 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccagacactctacttctccacaattaaattgtgtgag |
31769482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 32984269 - 32984179
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| |||||||||| |||| | ||||||| ||||||||||| ||||||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
32984269 |
ttggtagggatattg-catattatatacaggagtcggggttcaaaccccggacactctacttctccacaattaaattgtgtgagctctaacc |
32984179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 44616620 - 44616710
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||| || |||||||| || |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
44616620 |
ttggtagggatattg-catattatatgcaggagccggggttcaaaacccggacactccacttctccacaattaaattgtgtgagctctaacc |
44616710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 5804873 - 5804974
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||| | ||||||||||||| | |||| |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
5804873 |
ttggtagggatattg-cattttatatgcaagggccgaggttcgaaccccgtatattccacttctccacaatttaattgtgtgagctctagccactaagct |
5804971 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
5804972 |
act |
5804974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 10244941 - 10244840
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| || ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
10244941 |
ttggtagggatattg-catattatatgtaggagccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
10244843 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
10244842 |
act |
10244840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 32619383 - 32619469
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| ||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
32619383 |
catattatatgtaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
32619469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 35645617 - 35645718
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||| || ||||||||||||| ||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
35645617 |
ttggtagggatattgt-atattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
35645715 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
35645716 |
act |
35645718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 42443707 - 42443808
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||| |||||||| || |||| | ||||||| | ||||||||| |||| || ||| ||| |
|
|
| T |
42443707 |
ttggtagggatattg-catattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaagttgtgtgagctctagccactaggct |
42443805 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
42443806 |
act |
42443808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 171 - 251
Target Start/End: Original strand, 11745224 - 11745304
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgcta |
251 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||| | ||||||| |||| |||||| ||||||| ||| |||| |
|
|
| T |
11745224 |
ttatatgcaggggtcgggggtcgaaccccggacactctacttctccacaattaaattatgtgagctctaaccactaggcta |
11745304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 24061366 - 24061294
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| ||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
24061366 |
catattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctcta |
24061294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 31077955 - 31077868
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||| | ||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
31077955 |
ttggtagggatatt-acactttatacgcaggggccgcggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
31077868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 155 - 239
Target Start/End: Complemental strand, 43633138 - 43633055
Alignment:
| Q |
155 |
tagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||| | |||||||||||||| || |||||||||| |||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
43633138 |
tagggatatt-atatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctcta |
43633055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 47999798 - 47999885
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| ||||||||||||| |||||||| || |||| | || |||| ||||||||||| |||| |
|
|
| T |
47999798 |
ttggtagggatattg-catattatatgtaggagctggggttcgaatcccggacactccacttctccataattaaattgtgtgagctcta |
47999885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 48447786 - 48447854
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
48447786 |
ttatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctcta |
48447854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 253
Target Start/End: Original strand, 4960805 - 4960903
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| ||||||||||||||| | |||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
4960805 |
gtagggatattg-catattatatgcaggagtcggggttcgaacccctgacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
4960903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 5990197 - 5990116
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| || ||| ||||||||||||||| || |||| | ||||||||||||||||||| |
|
|
| T |
5990197 |
ttggtagggatattgt-atattatatgcaggcgc-gggattcgaaccccggacactccacttctccacaatttaattgtgtgag |
5990116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 15106743 - 15106661
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||||||||||| |||| || |||| | ||||||| ||||||||||| |
|
|
| T |
15106743 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccagacactccacttctccacaattaaattgtgtgag |
15106661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 21875665 - 21875590
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| || |||| | || |||| ||||||||||| ||||||| |
|
|
| T |
21875665 |
catattatatgcaggggtcggagttcgaaccccggacactccacttttccataattaaattgtgtgagctctaacc |
21875590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 231
Target Start/End: Complemental strand, 33636830 - 33636771
Alignment:
| Q |
172 |
tatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| | ||||| | |||||||| |
|
|
| T |
33636830 |
tatatgcaggggctggggttcgaaccccggacatttcacttctccacaaataaattgtgt |
33636771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 12264072 - 12264173
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| || |||||||||| | ||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
12264072 |
ttggtagggatattg-cattttatatgcaggggccggagttcgaaccctgaacactccacttctccacaattaaattgtgtgagctctatccactaggct |
12264170 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
12264171 |
act |
12264173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 12772133 - 12772234
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||| | || |||| | || |||| ||||||||||| |||| || ||| ||| |
|
|
| T |
12772133 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggatactccacttctccataattaaattgtgtgagctctagccactaggct |
12772231 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
12772232 |
act |
12772234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 205
Target Start/End: Original strand, 21066904 - 21066957
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacat |
205 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
21066904 |
ttggtagggatattg-catattatatgtaggggccggggttcgaaccccggacat |
21066957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 27424872 - 27424957
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||| | || |||| | ||| ||||||||||||||| |||| || ||| |||||| |
|
|
| T |
27424872 |
catattatatgcaggggccggggttcgaacctcggatactccacttctccac-atttaattgtgtgagctctagccactaggctact |
27424957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 27510309 - 27510208
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||| ||||| ||| || | || | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
27510309 |
ttggtagggatattg-catattatatgcaggagccggggttcgatccccgtacactccatttctccacaattaaattgtgtgagctctagccactaggct |
27510211 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
27510210 |
act |
27510208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 31191637 - 31191551
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
31191637 |
catattatatgcagggatcggagttcgaaccccggacactccacttctgcacaattaaattgtgtgagctctagccactaagctact |
31191551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 21388541 - 21388593
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
21388541 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggaca |
21388593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 240
Target Start/End: Complemental strand, 30004601 - 30004513
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaa |
240 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| |||||||||||| ||| || || |||| | ||||||||||| ||||||| ||||| |
|
|
| T |
30004601 |
ttggtagggatatt-acatattatatataggggtcggggttcgaacctcggccactccacttctccacaatttaatcgtgtgagctctaa |
30004513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 154 - 239
Target Start/End: Original strand, 32047110 - 32047194
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||| |||||||||||||| ||||||||||||||||||| |||| | ||||||| ||||||||||| |||| |
|
|
| T |
32047110 |
gtagggatattg-catgttatatgcaggggccggggttcgaaccccggacacctcacttctccacaattaaattgtgtgagctcta |
32047194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 48525607 - 48525644
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48525607 |
catattatatgcaggggttggggttcgaaccccggaca |
48525644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 231
Target Start/End: Original strand, 2681114 - 2681193
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || ||| | ||||||| |||||||| |
|
|
| T |
2681114 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactccccttctccacaattaaattgtgt |
2681193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 3158885 - 3158945
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
|||||| |||||||||| ||||||||||| |||| ||||||| | ||||||| |||||||| |
|
|
| T |
3158885 |
ttatatacaggggctggagttcgaaccccagacactctacttttccacaattaaattgtgt |
3158945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 7525477 - 7525549
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||| | |||||||| ||||||| ||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
7525477 |
catattatatgcaggggtcgaggttcgaattccggacactctacttctccacaattaaattgtgtgagctcta |
7525549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 234
Target Start/End: Complemental strand, 12007824 - 12007766
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||| | ||||| ||||||||||||| |
|
|
| T |
12007824 |
tatgcaggggctggggttcgaaccccggacactc-acttctccacaa-ttaattgtgtgag |
12007766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 29238952 - 29239020
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
29238952 |
ttatgtgcaggggcaggggttcgtaccccggacactccacttctccacaattaaattgtgtgagatcta |
29239020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 33996933 - 33996846
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||| ||||| || |||| | || |||| ||||||||||| |||| |
|
|
| T |
33996933 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccctggacactccacttctccataattaaattgtgtgagctcta |
33996846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 35683160 - 35683092
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
35683160 |
ttatatgcaggggtcggggttcgaactccggacactccacttctccacaattaaattgtgtgagctcta |
35683092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 42182235 - 42182163
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| || ||| | |||||||||||||| |||| |||| |
|
|
| T |
42182235 |
catattatatgcaggggtcggggttcgaactccggacactccactcctccacaatttaattgtatgagctcta |
42182163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 46534800 - 46534713
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || | |||||||||||| ||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
46534800 |
ttggtagggatattg-catattatatgcaggagcctgagttcgaaccccgaacactccacttctccacaattaaattgtgtgagctcta |
46534713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 47144939 - 47145007
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||| || ||| |||||||||||||| |||| | |||| ||||||||| |||||||||||||||| |
|
|
| T |
47144939 |
ttatatgtagaggcaggggttcgaaccccagacaccccactttttcacaattaaattgtgtgagttcta |
47145007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 48674595 - 48674527
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| || |||| | || |||| ||||||||||| |||| |
|
|
| T |
48674595 |
ttatatgcaggggttggggttcaaaccccggacactccacttctccataattaaattgtgtgagctcta |
48674527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 253
Target Start/End: Original strand, 3062826 - 3062893
Alignment:
| Q |
186 |
ggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
3062826 |
ggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
3062893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 7465498 - 7465533
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7465498 |
tattatatgcaggggccggggttcgaaccccggaca |
7465533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 242
Target Start/End: Original strand, 12615784 - 12615859
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||||||| |||| ||||||| ||||||| | ||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
12615784 |
catattatatgcaggggttgggattcgaactccggacaccccgcttctccacaattaaattgtgtgagctctaacc |
12615859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 24188503 - 24188570
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| | |||| | ||||||| ||||||||||| |
|
|
| T |
24188503 |
catattatatgcaggggtcggggttcgaaccccagacaccccacttctccacaattaaattgtgtgag |
24188570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 24479615 - 24479650
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24479615 |
tattatatggaggggctggggttcgaaccccggaca |
24479650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 26122082 - 26122137
Alignment:
| Q |
186 |
ggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
||||||||||||||||||| || |||| | ||||||| ||||||||||| |||||| |
|
|
| T |
26122082 |
ggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaac |
26122137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 28424368 - 28424293
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| || | ||||||||||||||| | | |||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
28424368 |
catattatatgcagaggacgaggttcgaaccccggaaaccccacttcttcacaattaaattgtgtgagctctaacc |
28424293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 28805318 - 28805408
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| |||||| |||||||||||| | |||| | ||||||| ||||| ||||| ||||||| |
|
|
| T |
28805318 |
ttggtagggatattg-catatcatatgcaggggtcggggttagaaccccggacaccccacttctccacaattaaattgagtgagctctaacc |
28805408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 31475903 - 31475868
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31475903 |
tattatatgcaggggctggggttcgaacccctgaca |
31475868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 34051911 - 34051837
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| ||| | |||| | ||||||| ||||||||||||||||||| |
|
|
| T |
34051911 |
catattatatgcaggggctgggat-cgaaccccatacaccccacttctccacaattaaattgtgtgagttctaacc |
34051837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 42887186 - 42887221
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42887186 |
tattatatgcaggggctgaggttcgaaccccggaca |
42887221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 173 - 239
Target Start/End: Complemental strand, 42931862 - 42931795
Alignment:
| Q |
173 |
atatgcaggggctgggg-ttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| || |||| | || ||||||||| ||||||||||| |
|
|
| T |
42931862 |
atatgcaggggctgggggttcgaaccctggacactcaacttctccataatttaattatgtgagttcta |
42931795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 44437888 - 44437853
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44437888 |
tattatatgcaggggccggggttcgaaccccggaca |
44437853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 239
Target Start/End: Original strand, 2023509 - 2023559
Alignment:
| Q |
189 |
gttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||| || |||| ||||||||| ||||||||||| |||| |
|
|
| T |
2023509 |
gttcgaaccccggacactccacttcttcacaattaaattgtgtgagctcta |
2023559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 197
Target Start/End: Complemental strand, 6973531 - 6973501
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaacc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6973531 |
catattatatgcaggggctggggttcgaacc |
6973501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 239
Target Start/End: Original strand, 7691926 - 7691976
Alignment:
| Q |
189 |
gttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||| |||||||||| |||| | ||||||||||||||||||| |||| |
|
|
| T |
7691926 |
gttcgaactccggacattccacttctccacaatttaattgtgtgagctcta |
7691976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 9497984 - 9498065
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| ||||||||||||||||||| | |||| | ||||||| |||| ||||| |
|
|
| T |
9497984 |
ttggtagggatattg-catattatatgtaggggtcggggttcgaaccccggacaccccacttctccacaattaaattatgtga |
9498065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 18503517 - 18503431
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| | |||| | |||| || || |||||||| | ||||| ||| |||||| |
|
|
| T |
18503517 |
catattatatgcaggggctgaggttcgaaccccagacaccccacttctccacatttaaaatgtgtgagctttaaccactaggctact |
18503431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 229
Target Start/End: Complemental strand, 35612604 - 35612542
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgt |
229 |
Q |
| |
|
|||||||||||||| || ||||||| |||||||||||| || |||| | ||||||| |||||| |
|
|
| T |
35612604 |
catattatatgcagaggttggggtttgaaccccggacactccacttctccacaattaaattgt |
35612542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 37665773 - 37665811
Alignment:
| Q |
166 |
acatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
37665773 |
acatattatatgcaggggccggggttcaaaccccggaca |
37665811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 47463968 - 47464030
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| | |||| | ||||||| |||||||||| |
|
|
| T |
47463968 |
ttatatgcaggggttggggttcgaacctcggacaccccacttctccacaattaaattgtgtga |
47464030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 1398940 - 1398903
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
1398940 |
catattatatgcaggggccggggttcgaatcccggaca |
1398903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 13730134 - 13730097
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
13730134 |
catattatatgcaggggccggggtttgaaccccggaca |
13730097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 14707326 - 14707359
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
14707326 |
ttatatgcaggggttggggttcgaaccccggaca |
14707359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 20101689 - 20101652
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
20101689 |
catattatatgcaggggccggggttcgaactccggaca |
20101652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 21285414 - 21285381
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
21285414 |
ttatatgcaggggccggggttcgaaccccggaca |
21285381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 150 - 199
Target Start/End: Original strand, 25149064 - 25149112
Alignment:
| Q |
150 |
tttggtagggatatttacatattatatgcaggggctggggttcgaacccc |
199 |
Q |
| |
|
|||| |||||||||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
25149064 |
tttgttagggatatt-acattttatatgcgggggctggggttcgaacccc |
25149112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 218
Target Start/End: Original strand, 25818318 - 25818367
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||| || |||| ||||| |
|
|
| T |
25818318 |
tattatatgcaggggctggagttcgaaccccgaacactccacttattcac |
25818367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 29658333 - 29658300
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
29658333 |
ttatatgcaggggccggggttcgaaccccggaca |
29658300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Original strand, 46645746 - 46645779
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
46645746 |
ttatatgcaggggccggggttcgaaccccggaca |
46645779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 218
Target Start/End: Original strand, 47552245 - 47552294
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||| |||||| ||||| |
|
|
| T |
47552245 |
tattatatgcaagggccggggttcgaaccccggacaccctacttattcac |
47552294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 2228993 - 2229080
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||| ||||||| || | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
2228993 |
ttggtagggatattg-catattatatgcaggggccggggtttaaaccccgagcaccccacttctccacaattaaattgtgtgagctcta |
2229080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 3532596 - 3532683
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| | |||||||||||| ||| || |||| | |||||| ||||||||||| |||| |
|
|
| T |
3532596 |
ttggtagggatattg-cataatatatgcaggggccgaggttcgaaccccaaacactccacttctctacaattaaattgtgtgagctcta |
3532683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 7401439 - 7401352
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| ||||| |||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
7401439 |
ttggtagggatattgt-atattatatgcaggaattggggtttgaacctcggacactccacttctccacaattaaattgtgtgagctcta |
7401352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 15020997 - 15021057
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||| || | || | ||||||||||||||| |
|
|
| T |
15020997 |
ttatatgcaagggttggggttcgaaccccggacactccatttttcgacaatttaattgtgt |
15021057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 24692493 - 24692580
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||| |||||||| | || ||| |||||||||||| || |||| || |||||| ||||||||||| |||| |
|
|
| T |
24692493 |
ttggtagggatattg-catattctatgcaggagtcggagtttgaaccccggacactccacttctttacaattaaattgtgtgagctcta |
24692580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 231
Target Start/End: Original strand, 27633949 - 27634028
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| | || | || || | ||||||||| |||||||| |
|
|
| T |
27633949 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaaccacagatactccacgtcttcacaattaaattgtgt |
27634028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 35815875 - 35815943
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||||||||| ||| |||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
35815875 |
ttatatgcaggggtcggggttcgaatcccagacactccacttctccacaattaaattgtgtgagctcta |
35815943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 217
Target Start/End: Original strand, 38025373 - 38025421
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttca |
217 |
Q |
| |
|
||||||||||||| | ||||||||||||| ||||||||| |||| |||| |
|
|
| T |
38025373 |
tattatatgcaggagttggggttcgaacctcggacattccacttattca |
38025421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 199
Target Start/End: Original strand, 41084057 - 41084104
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaacccc |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
41084057 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaacccc |
41084104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 239
Target Start/End: Complemental strand, 45669818 - 45669738
Alignment:
| Q |
159 |
gatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||| ||||||||||||| || | ||||||||||||||||| || | || | ||||||| ||||||||||| |||| |
|
|
| T |
45669818 |
gatatttgcatattatatgcaacagccgaggttcgaaccccggacactccatttctccacaattaaattgtgtgagctcta |
45669738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 199
Target Start/End: Original strand, 49054028 - 49054060
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaacccc |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
49054028 |
catattatatgcagggactggggttcgaacccc |
49054060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 109)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 30390421 - 30390320
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| |||||| | ||||||||||||||||||| ||||||| ||| ||| |
|
|
| T |
30390421 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacaccctacttctccacaatttaattgtgtgagctctaaccactaggct |
30390323 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
30390322 |
act |
30390320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 34613997 - 34614084
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
34613997 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacactctacttctccacaattaaattgtgtgagctcta |
34614084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 233
Target Start/End: Complemental strand, 8742876 - 8742795
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||||||||||||||||||| ||| || |||| |||||||||||||||||||| |
|
|
| T |
8742876 |
ttggtagagatatt-acatattatatgtaggggctggggttcgaaccccgcacactccactttttcacaatttaattgtgtga |
8742795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 36182660 - 36182761
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
36182660 |
ttggtagggatattg-catattatatgcaggagcaggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggct |
36182758 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
36182759 |
act |
36182761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 19281626 - 19281713
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
19281626 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
19281713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 31223638 - 31223720
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||| |||| || |||| | ||||||||||||||||||| |
|
|
| T |
31223638 |
ttggtagggatattg-catattatatgcaggggctggggtttgaaccccagacactccacttctccacaatttaattgtgtgag |
31223720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 1309163 - 1309077
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
1309163 |
catattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
1309077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 2643715 - 2643816
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
2643715 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaagct |
2643813 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
2643814 |
act |
2643816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 4562804 - 4562703
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
4562804 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
4562706 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
4562705 |
act |
4562703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 5521257 - 5521171
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||| || |||| | |||||||||||||||||||||||| || ||| |||||| |
|
|
| T |
5521257 |
catattatatgcaggggccgaggttcgaaccctggacactccacttttccacaatttaattgtgtgagttctagccactaggctact |
5521171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 5612987 - 5613073
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| | |||| | ||||||||||||||||||| ||||||| ||| |||||| |
|
|
| T |
5612987 |
catattatatgcaagggccggggttcgaaccccggacaccccacttctccacaatttaattgtgtgagctctaaccactaggctact |
5613073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 33228985 - 33228884
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
33228985 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
33228887 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
33228886 |
act |
33228884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 34355739 - 34355840
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||| |||| || |||| | |||||||||||||| |||| ||||||| ||| ||| |
|
|
| T |
34355739 |
ttggtagggatattgt-atattatatgcaggggccggggttcgaaccccagacactccacttctccacaatttaattgtatgagctctaaccactaagct |
34355837 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
34355838 |
act |
34355840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 40535486 - 40535400
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
40535486 |
catattatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
40535400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 40688672 - 40688590
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||| | ||||||| ||||||||||| ||||||| ||| |||||| |
|
|
| T |
40688672 |
ttatatgcaggggccagggttcgaaccccggacactctacttctccacaattaaattgtgtgagctctaaccactaggctact |
40688590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 41509534 - 41509635
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
41509534 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
41509632 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
41509633 |
act |
41509635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 11050809 - 11050722
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||| | |||| | || |||| ||||||||||| |||| |
|
|
| T |
11050809 |
ttggtagggatatt-acatattatatgcaggggctggggttcgaactccggacaccccacttctccataattaaattgtgtgagctcta |
11050722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 17487722 - 17487809
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||| | |||| | ||||||| ||||| |||||||||| |
|
|
| T |
17487722 |
ttggtagggatattg-catattatatgcagtggctggggttcgaaccccggacacttcacttctccacaattaaattgagtgagttcta |
17487809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 29449466 - 29449553
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||||||||| |||| ||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
29449466 |
ttggtagggatatc-acattttatatgcaggggccggggttcgaaccccagacactctacttctccacaattaaattgtgtgagctcta |
29449553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 1500979 - 1501057
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtg |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| || |||| | || |||||||||||| |
|
|
| T |
1500979 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagacactccacttctccataatttaattgtg |
1501057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 30392884 - 30392794
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| | |||||||||||||| |||| || |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
30392884 |
ttggtagggatattg-catattatatgtaggagtcggggttcgaaccccagacactccacttgttcacaattaaattgtgtgagctctaacc |
30392794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 1844835 - 1844936
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||| |||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
1844835 |
ttggtagggatattg-catattatatgcaggggccggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
1844933 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
1844934 |
act |
1844936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 2289643 - 2289729
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| || ||| | ||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
2289643 |
catattatatgcaggggtcagggttcgaaccctggacactccccttctccacaatttaattgtgtgagttctaaccactaggctact |
2289729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 20296451 - 20296537
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
20296451 |
catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
20296537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 25857347 - 25857246
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| ||||||| || |||| | ||||||| | ||||||||| |||| || ||| ||| |
|
|
| T |
25857347 |
ttggtagggatattg-catattatatgcaggagctggggttcgaacaccggacactccacttctccacaattaacttgtgtgagctctagccactaggct |
25857249 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
25857248 |
act |
25857246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 29772330 - 29772229
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||| |||| || | || | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
29772330 |
ttggtagggatattg-catattatatgtcggggctggggttcgaaccccagacactccaattctccacaatttaattgtgtgagctctagccactaggct |
29772232 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
29772231 |
act |
29772229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 39408742 - 39408641
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||| | || |||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| || ||||||| |
|
|
| T |
39408742 |
ttggtagggatattg-catattatatgcaagagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccactatgct |
39408644 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
39408643 |
act |
39408641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 44857286 - 44857185
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||||||||||||||||| || |||| | || ||||||||||||| || |||| || ||| ||| |
|
|
| T |
44857286 |
ttggtagggatattg-catattatatgcaggggccgaggttcgaaccccggacactccacttctccataatttaattgtgtaagctctagccactaggct |
44857188 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
44857187 |
act |
44857185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 167 - 252
Target Start/End: Original strand, 8322839 - 8322924
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctac |
252 |
Q |
| |
|
|||||||||| |||||| ||||||||||||| |||||| | |||| | |||||||||||||| |||||||||||| ||| ||||| |
|
|
| T |
8322839 |
catattatatacaggggtcggggttcgaaccctggacatcccacttctccacaatttaattgtatgagttctaaccactaggctac |
8322924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 2305104 - 2305176
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| | ||||| || |||| | |||||||||||||||||||||||| |
|
|
| T |
2305104 |
catattatatgcaggggccggggttcaaactctggacactccacttctccacaatttaattgtgtgagttcta |
2305176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 3438966 - 3439053
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
3438966 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
3439053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 15069832 - 15069764
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| || |||| |||| |||||||||||||||| |||| |
|
|
| T |
15069832 |
ttatatgcaggggtcggggttcgaaccccggacactccacttcttcataatttaattgtgtgagctcta |
15069764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 18278469 - 18278382
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||| |||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
18278469 |
ttggtagggatattg-catattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctcta |
18278382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 19684091 - 19684177
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
19684091 |
ttggtagggatattg-catattatatgcaggagctggggttcgaacccc-gacactccacttctccacaattaaattgtgtgagctcta |
19684177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 28194665 - 28194737
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
28194665 |
catattatatgcaggggctggagttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
28194737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 36005460 - 36005547
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
36005460 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctcta |
36005547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 44186461 - 44186548
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||| |||||||||| |||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
44186461 |
ttggtagggatatt-acatattatatgcagcggctgtggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctcta |
44186548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 44948614 - 44948701
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | ||||||||||||| ||||| | |||| | ||||||||||||||||||||||| |
|
|
| T |
44948614 |
ttggtagggatattg-catattatatgcagggaccggggttcgaaccctggacactgcacttctctacaatttaattgtgtgagttcta |
44948701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 8250353 - 8250263
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||| |||| | || | | ||||||| ||||||||||| ||||||| |
|
|
| T |
8250353 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccagacacttcacctctccacaattaaattgtgtgagctctaacc |
8250263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 11093825 - 11093750
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
11093825 |
catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaacc |
11093750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 33041915 - 33041825
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| |||||||||||||| ||| |||||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
33041915 |
ttggtagggatattg-catattatatgcaaaggccagggttcgaaccccgaacaccctacttcttcacaattaaattgtgtgagctctaacc |
33041825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 6331580 - 6331680
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||| ||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
6331580 |
ttggtagggatattg-catattatatgcaggagccggg-ttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
6331677 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
6331678 |
act |
6331680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 18694803 - 18694904
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||| ||| |||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
18694803 |
ttggtagggatattg-catattatatgcaggaactggggttcgaatcccagacactccacttctccacaattaaattgtgtgagctctagccactaggct |
18694901 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
18694902 |
act |
18694904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 170 - 240
Target Start/End: Original strand, 25093500 - 25093570
Alignment:
| Q |
170 |
attatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaa |
240 |
Q |
| |
|
|||||||||||| || |||||||||| |||||||| || |||| | ||||||||||||||||||| ||||| |
|
|
| T |
25093500 |
attatatgcaggagccggggttcgaatcccggacactccacttttccacaatttaattgtgtgagctctaa |
25093570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 154 - 240
Target Start/End: Original strand, 27082341 - 27082426
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaa |
240 |
Q |
| |
|
||||||||||| | ||||||||||||||||| || ||||||| || ||||| || |||| | ||||||||||||||||||| ||||| |
|
|
| T |
27082341 |
gtagggatatt-atatattatatgcaggggccggagttcgaaacctggacactccacttctccacaatttaattgtgtgagctctaa |
27082426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 27913521 - 27913421
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||| |||| || |||| | |||||||||||||||| || ||||||| ||| ||| |
|
|
| T |
27913521 |
ttggtagggatattg-catattatatgcagggt-tggggttcgaaccctagacactccacttctccacaatttaattgtgtaagctctaaccactaggct |
27913424 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
27913423 |
act |
27913421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 41566795 - 41566881
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||| ||| ||||||| ||| |||| || |||| | ||||||||||||||||||| |||| || ||| |||||| |
|
|
| T |
41566795 |
catattatatgcaggggttggagttcgaatcccagacactccacttctccacaatttaattgtgtgagctctagccactaggctact |
41566881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 253
Target Start/End: Original strand, 1071504 - 1071589
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||| | |||| || ||| |||||| |
|
|
| T |
1071504 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgtgctctagccactaggctact |
1071589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 253
Target Start/End: Original strand, 13773434 - 13773519
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||| ||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| ||||||| ||| |||||| |
|
|
| T |
13773434 |
atattatatgtaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctact |
13773519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 28692534 - 28692450
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||| ||||||||||||| ||||||||||||| ||||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
28692534 |
gtagggatattg-cattttatatgcaggggtcggggttcgaacccaggacactccacttctccacaatttaattgtgtgagctcta |
28692450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 229
Target Start/End: Complemental strand, 34434430 - 34434369
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgt |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||| |||| | |||||||||||||| |
|
|
| T |
34434430 |
atattatatgcaggggttggggttcgaaccccacacattccacttctccacaatttaattgt |
34434369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 35972611 - 35972559
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||| ||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35972611 |
ttggtaggaatatt-acatattttatgcaggggctggggttcgaaccccggaca |
35972559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 36101692 - 36101729
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36101692 |
catattatatgcaggggctggggttcgaaccccggaca |
36101729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 38387681 - 38387733
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38387681 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagaca |
38387733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 3287093 - 3287022
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| | || |||| | ||| ||||||||||||||| |||| |
|
|
| T |
3287093 |
catattatatgcaggggccggggttcgaaccccggatactccacttctccac-atttaattgtgtgagctcta |
3287022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 22653696 - 22653609
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| |||||| |||| |||| |
|
|
| T |
22653696 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtatgagctcta |
22653609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 9330538 - 9330471
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| ||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
9330538 |
catattatatgcaggggctgaggtgcgaactccggacactccacttatccacaattaaattgtgtgag |
9330471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 16040259 - 16040349
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||| |||| |||||||| ||||||| |||| |||||||| | |||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
16040259 |
ttggtagggatattg-catgttatttgcaggggttggggtttgaactccggacatcccacttctccacaattaaattgtgtgagctctaacc |
16040349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 239
Target Start/End: Complemental strand, 22718097 - 22718026
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||| || |||| | ||||||| ||| ||||||| |||| |
|
|
| T |
22718097 |
atattatatgcaggagctggggttcgaaccccgaacactccacttctccacaattaaatcgtgtgagctcta |
22718026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 40363123 - 40363034
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| |||||||||||||| |||| ||||||| | || ||||||||||||||| ||||||| |
|
|
| T |
40363123 |
ttggtagggatattg-catattatatgtaggggtcggggttcgaacccccgacactctacttctcca-tatttaattgtgtgagctctaacc |
40363034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 44666380 - 44666306
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||| |||| | ||||| ||||||||||||| ||||||| |
|
|
| T |
44666380 |
cataatatatgcagggatcggggttcgaaccccggacattccacttctccacaa-ttaattgtgtgagctctaacc |
44666306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 4183194 - 4183275
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||| ||| || |||| | ||||||| |||||||||| |
|
|
| T |
4183194 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccgaacactccacttctccacaattaaattgtgtga |
4183275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 7907595 - 7907494
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| ||||||||| | ||| | |||| | |||||||||||||||||||||||||| ||| ||| |
|
|
| T |
7907595 |
ttggtagggatattg-catattatatggtggggctggagttcgaaccacaaacaccccacttctctacaatttaattgtgtgagttctaaccactaggct |
7907497 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
7907496 |
act |
7907494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 17034753 - 17034854
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||||||| |||||||| || |||| | ||||||| |||| |||||| |||| || ||| ||| |
|
|
| T |
17034753 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaatcccggacactccacttctccacaattaaattatgtgagctctagccactaggct |
17034851 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
17034852 |
act |
17034854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 17601097 - 17601198
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| || ||||||||| ||||| || |||| | |||||||||||| |||||| ||||||| ||| ||| |
|
|
| T |
17601097 |
ttggtagggatattg-catatcatatgcaggggtcggagttcgaaccatggacactccacttctccacaatttaattatgtgagctctaaccactacgct |
17601195 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
17601196 |
act |
17601198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 239
Target Start/End: Original strand, 3301828 - 3301916
Alignment:
| Q |
150 |
tttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||| ||||||||||||||| ||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
3301828 |
tttggtagggatattg-cattttatatacaggggtcggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctcta |
3301916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 5398159 - 5398107
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
5398159 |
ttggtagggatatt-acattttatatgcagaggctggggttcgaaccccagaca |
5398107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 6636019 - 6635967
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
6636019 |
ttggtagggatattg-catattatatgcagggacgggggttcgaaccccggaca |
6635967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 176 - 253
Target Start/End: Original strand, 21438877 - 21438953
Alignment:
| Q |
176 |
tgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||| |||||||||||||||||||| ||| || |||| | ||||||||||||||||||| ||||| | ||| |||||| |
|
|
| T |
21438877 |
tgcatgggctggggttcgaaccccg-acactccacttctccacaatttaattgtgtgagctctaatcactacgctact |
21438953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 168 - 241
Target Start/End: Complemental strand, 33549090 - 33549017
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||| | |||| | ||||||| ||||||||||| |||||| |
|
|
| T |
33549090 |
atattatatgcaggagctggggttcgaaccccaaacacttcacttctccacaattaaattgtgtgagctctaac |
33549017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 38179297 - 38179245
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
38179297 |
ttggtagggatattg-cattttatatgcaggggctggggttcgaacctcggaca |
38179245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 27297193 - 27297280
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||| |||||||| |||||| ||||||||||||||| || |||| | || |||| || |||||||| |||| |
|
|
| T |
27297193 |
ttggtagggatattg-catattgtatgcaggagctgggattcgaaccccggacactccacttctccataattaaactgtgtgagctcta |
27297280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 33262479 - 33262547
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| || |||| | ||||||| |||||||||| ||||| |
|
|
| T |
33262479 |
ttatatgcaggggtcggggttcgaacctcggacactccacttctccacaattaaattgtgtgaattcta |
33262547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 40473583 - 40473515
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
40473583 |
ttatatgcaggggctggggtttgaacctcggacaccccacttctccacaattaaattgtgtgagctcta |
40473515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 580846 - 580811
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
580846 |
tattatatgcaggggccggggttcgaaccccggaca |
580811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 17154681 - 17154716
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17154681 |
tattatatgcaggggccggggttcgaaccccggaca |
17154716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 22297515 - 22297480
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22297515 |
tattatatgcaggggcaggggttcgaaccccggaca |
22297480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 29035008 - 29035043
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29035008 |
tattatatgcaggggccggggttcgaaccccggaca |
29035043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 32854549 - 32854632
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||| | ||| ||||||||| |||| ||||||||||||||||||| |||||| | |||| || || |||||||| |
|
|
| T |
32854549 |
ttggtagggataaatgcattttatatgcaagggccggggttcgaaccccggacaccctacttctccacatttaaaatgtgtgag |
32854632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 34149717 - 34149650
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| |||||| | ||||||| ||||||||||| |
|
|
| T |
34149717 |
catattatatgcagtgatcggggttcgaaccccggacaccctacttctccacaattaaattgtgtgag |
34149650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 174 - 233
Target Start/End: Original strand, 44558042 - 44558100
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||| | ||| |||||||||||||| |
|
|
| T |
44558042 |
tatgcaggggctggggttcgaaccccggacaccccacttctccac-atttaattgtgtga |
44558100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 171 - 253
Target Start/End: Original strand, 44822460 - 44822543
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaattt-aattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| || |||||||||||||| |||| || |||| | |||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
44822460 |
ttatatgcaggagccggggttcgaaccccagacactccacttctccacaatttaaattgtgtgagctctagccactaggctact |
44822543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 233
Target Start/End: Complemental strand, 466658 - 466577
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| |||||||||||||| | | |||||||||| |||||||| || | || | ||||||| |||||||||| |
|
|
| T |
466658 |
ttggtagggatatt-acatattatatgcaagagtcggggttcgaaacccggacactccaattctccacaattaaattgtgtga |
466577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 204
Target Start/End: Original strand, 11832973 - 11833018
Alignment:
| Q |
158 |
ggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
11832973 |
ggatattt-catattatatgtaggggctggggttcgaaccacggaca |
11833018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 15233431 - 15233531
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| || |||| |||||| |||| || |||| | || | |||||||||||||||||| || ||| ||| |
|
|
| T |
15233431 |
ttggtagggatattg-catattatatgcaggggccggagttcaaaccccagacactccacttctctac-agttaattgtgtgagttctagccactaagct |
15233528 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
15233529 |
act |
15233531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 17089276 - 17089362
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| | |||||||||| |||||||| || |||| | ||||||| |||| |||||| |||| || ||| |||||| |
|
|
| T |
17089276 |
catattatatgcaggagtcggggttcgaatcccggacactccacttctccacaattaaattatgtgagctctagccactaggctact |
17089362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 166 - 239
Target Start/End: Original strand, 1232224 - 1232297
Alignment:
| Q |
166 |
acatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||| ||||||||||||| || |||||||| |||||||| || |||| | || |||| |||||||| ||||||| |
|
|
| T |
1232224 |
acattttatatgcaggggttgaggttcgaatcccggacactccacttctccataattaaattgtgtaagttcta |
1232297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 3037683 - 3037650
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
3037683 |
ttatatgcaggggccggggttcgaaccccggaca |
3037650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 3446748 - 3446800
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || | ||||||||||||||||| |
|
|
| T |
3446748 |
ttggtagggatattg-catattatatgcaggagccgaggttcgaaccccggaca |
3446800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 15764948 - 15765000
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||| ||| |||| |
|
|
| T |
15764948 |
ttggtagggatattg-catattatatgcaggggttggggttcgaatcccagaca |
15765000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 166 - 239
Target Start/End: Original strand, 18073775 - 18073848
Alignment:
| Q |
166 |
acatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||| ||||||||| ||| || ||||||| |||||||| || |||| | ||||||| |||||||||||||||| |
|
|
| T |
18073775 |
acattttatatgcaaaggccggagttcgaatcccggacactccacttctccacaattaaattgtgtgagttcta |
18073848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 19612733 - 19612785
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| ||||||||||||||||| |||| |
|
|
| T |
19612733 |
ttggtagggatattg-catattatatgtaggagctggggttcgaaccccagaca |
19612785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 33233230 - 33233177
Alignment:
| Q |
186 |
ggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||| || |||| | ||||||| |||||||||||||||| |
|
|
| T |
33233230 |
ggggttcgaactccggacactccacttctccacaattaaattgtgtgagttcta |
33233177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 37063538 - 37063590
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
37063538 |
ttggtagggatattg-catattatatgcaggggccagggttcgaactccggaca |
37063590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 38400328 - 38400433
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctgg----ggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaaccccta |
246 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| || ||||||||||| ||||| | |||| | ||||||| ||||||||||| |||| || ||| |
|
|
| T |
38400328 |
ttggtagggatattg-catattatatgcaggggccggccggggttcgaaccctggacaccccacttctccacaattaaattgtgtgagctctagccacta |
38400426 |
T |
 |
| Q |
247 |
tgctact |
253 |
Q |
| |
|
|||||| |
|
|
| T |
38400427 |
ggctact |
38400433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 7281740 - 7281654
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | | |||||| |||||||| || |||| | |||||| ||||||||||| |||| |
|
|
| T |
7281740 |
ttggtagggatattg-catattatatgcaggggccgag-ttcgaatcccggacactccacttctctacaattaaattgtgtgagctcta |
7281654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 11189965 - 11190033
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||| ||||||||| ||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
11189965 |
ttatatgcaggggtcgggggtcgaaccccagacatcccacttctccacaattaaattgtgtgagctcta |
11190033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 14215919 - 14215987
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||||||||| || |||| | |||| | ||||||||||||||||||| |||| |
|
|
| T |
14215919 |
ttatatgcaggagctggggttcgaattccagacacttcacttctccacaatttaattgtgtgagctcta |
14215987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 16385075 - 16385007
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||| | | ||||||||||| ||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
16385075 |
ttatatgcagagaccggggttcgaactccggacactccacttctccacaattaaattgtgtgagctcta |
16385007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 17777199 - 17777163
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17777199 |
atattatatgcaggggtcggggttcgaaccccggaca |
17777163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 239
Target Start/End: Complemental strand, 24506774 - 24506710
Alignment:
| Q |
175 |
atgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||| || |||| ||||||||||| || |||| | |||||||||||| |||||| |||| |
|
|
| T |
24506774 |
atgcaggggccggtgttcaaaccccggacactccacttctccacaatttaattctgtgagctcta |
24506710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 204
Target Start/End: Complemental strand, 26975358 - 26975326
Alignment:
| Q |
172 |
tatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
26975358 |
tatatgcagaggctggggttcgaaccccggaca |
26975326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 27016310 - 27016382
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||| |||||| || |||||||||| ||||| || |||| | ||||| ||||||||||||| |||| |
|
|
| T |
27016310 |
catattatatacaggggtcggagttcgaaccctggacactccacttctccacaacttaattgtgtgagctcta |
27016382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 28153194 - 28153107
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
28153194 |
ttggtagggatattg-catgttatatgcaggattcggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
28153107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 240
Target Start/End: Complemental strand, 30849808 - 30849736
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaa |
240 |
Q |
| |
|
|||||||||| |||||| || ||| ||||||| ||| || |||| ||||||||| ||||||||||| ||||| |
|
|
| T |
30849808 |
atattatatgtaggggccggagtttgaaccccaaacactccacttcttcacaattaaattgtgtgagctctaa |
30849736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 217
Target Start/End: Complemental strand, 33116270 - 33116222
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttca |
217 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| |||||| |||| |
|
|
| T |
33116270 |
tattatattcaggggccggggttcgaaccccggacaccctacttattca |
33116222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 38557256 - 38557188
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| | |||| | |||||| ||||||||||| |||| |
|
|
| T |
38557256 |
ttatatgcaggggtcggggttcgaaccccggacacttcacttatctacaattaaattgtgtgagctcta |
38557188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 40864436 - 40864504
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| || | || | ||||| |||||||| |||| |||| |
|
|
| T |
40864436 |
ttatatgcaggggccggggttcgaacaccggacactccaattctccacaacttaattgtatgagctcta |
40864504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 43895931 - 43896018
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||| ||||||||| |||| |||||| |||||| ||||| || |||| | |||||| ||||||||||| |||| |
|
|
| T |
43895931 |
ttggtagggatatc-acattttatatgcaagggccggggtttgaaccctggacactccacttctctacaattaaattgtgtgagctcta |
43896018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 17638 - 17739
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
17638 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
17736 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
17737 |
act |
17739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 65839 - 65738
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| ||||||||||| |||||||| || |||| ||||||||||||||||||||| ||||| | ||| ||| |
|
|
| T |
65839 |
ttggtagggatattg-catattatatgtaggggttggggttcgaatcccggacactccacttcttcacaatttaattgtgtgagctctaatcactaggct |
65741 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
65740 |
act |
65738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 106)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 241
Target Start/End: Original strand, 5900310 - 5900398
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||| |||||||||||||||||| |||| | ||||||||||||||||||| |||||| |
|
|
| T |
5900310 |
ttggtagggatattg-catattatatgcaggggccggg-ttcgaaccccggacattccacttctccacaatttaattgtgtgagctctaac |
5900398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 17545224 - 17545123
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| || |||| | || |||||||||||||||| |||| || ||| ||| |
|
|
| T |
17545224 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacactccacttctccataatttaattgtgtgagctctagccactaggct |
17545126 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
17545125 |
act |
17545123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 6518828 - 6518741
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
6518828 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
6518741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 8478945 - 8478858
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||| ||| || |||| ||||||||||||||||||||| |||| |
|
|
| T |
8478945 |
ttggtagggatattg-catattatatgcaggggctgtggttcgaaccccatacactccacttcttcacaatttaattgtgtgagctcta |
8478858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 168 - 239
Target Start/End: Original strand, 32423599 - 32423670
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| || |||| | |||||||||||||||||||||||| |
|
|
| T |
32423599 |
atattatatgcaggggctggggttcaaaccccagacactccacttctccacaatttaattgtgtgagttcta |
32423670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 8968767 - 8968868
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
8968767 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
8968865 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
8968866 |
act |
8968868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 9835051 - 9835152
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
9835051 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
9835149 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
9835150 |
act |
9835152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 11188719 - 11188633
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||| || |||| | ||||||||||||||||||| |||| || ||| |||||| |
|
|
| T |
11188719 |
catattatatgcaggggctggggttcaaaccccagacactcaacttctccacaatttaattgtgtgagctctagccactaggctact |
11188633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 12463774 - 12463875
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
12463774 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
12463872 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
12463873 |
act |
12463875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 25400419 - 25400318
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
25400419 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
25400321 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
25400320 |
act |
25400318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 2362987 - 2363075
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaa-ccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||| |||| |||| || |||| ||||||||||||||||||||| |||| |
|
|
| T |
2362987 |
ttggtagggatattg-catattatatgcaggggttggggttcgaacccccagacactccacttcttcacaatttaattgtgtgagctcta |
2363075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 251
Target Start/End: Original strand, 546820 - 546919
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| || |||| | |||| ||||||||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
546820 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaacctcgaacatcccacttcttcacaattaaattgtgtgagctctaaccactaggct |
546918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 4417737 - 4417650
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
4417737 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
4417650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 16386793 - 16386706
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||| | || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
16386793 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctcta |
16386706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 21918070 - 21918157
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||| ||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
21918070 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctcta |
21918157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 32505706 - 32505793
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
32505706 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
32505793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 39886264 - 39886177
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| |||||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
39886264 |
ttggtagggatattg-catattatatgtaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
39886177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 42525418 - 42525505
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
42525418 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
42525505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 154 - 253
Target Start/End: Complemental strand, 11774508 - 11774410
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
11774508 |
gtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccgctaggctact |
11774410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 4745928 - 4745827
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
4745928 |
ttggtagggatattg-catattatatgaaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
4745830 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
4745829 |
act |
4745827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 241
Target Start/End: Complemental strand, 6735841 - 6735752
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| ||||||||||||||| ||| || |||| | ||||||| ||||||||||| |||||| |
|
|
| T |
6735841 |
ttggtagggatattt-cattttatatgcaggggtcggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctaac |
6735752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 14641161 - 14641060
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||| ||| |||| || ||| ||| |
|
|
| T |
14641161 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgcgagctctagccactaggct |
14641063 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
14641062 |
act |
14641060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 35515530 - 35515631
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
35515530 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagccactaggct |
35515628 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
35515629 |
act |
35515631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 36888447 - 36888346
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
36888447 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaagct |
36888349 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
36888348 |
act |
36888346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 6558819 - 6558906
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||| ||||||| |||||| | ||||||| ||||||||||| |||| |
|
|
| T |
6558819 |
ttggtagggatattg-catattatatgcaggggtcggggttcgaactccggacaccctacttctccacaattaaattgtgtgagctcta |
6558906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 11897266 - 11897353
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
11897266 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
11897353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 13958415 - 13958487
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| || |||| | || |||||||||||||||| |||| |
|
|
| T |
13958415 |
catattatatgcaggggacggggttcgaaccccggacactccacttctccataatttaattgtgtgagctcta |
13958487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 18050212 - 18050284
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| || |||| | ||||||||||||||||||| |||| |
|
|
| T |
18050212 |
catattaaatgcaggggtcggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctcta |
18050284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 18638635 - 18638703
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
18638635 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
18638703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 24033095 - 24033182
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
24033095 |
ttggtagggatattg-cattttatatgcaggggccggggttcgaaccccggacacgccacttctccacaattaaattgtgtgagctcta |
24033182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 27798639 - 27798726
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||| | || |||||||||||||||||| ||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
27798639 |
ttggtagggatattg-catattatatgcaagagccagggttcgaaccccggacactctacttctccacaattaaattgtgtgagctcta |
27798726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 32706340 - 32706427
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||| ||| || ||| ||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
32706340 |
ttggtagggatatt-acatattatatggaggagccgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
32706427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 43580896 - 43580983
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||| |||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
43580896 |
ttggtagggatattg-catattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctcta |
43580983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 5966847 - 5966925
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtg |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||| |
|
|
| T |
5966847 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
5966925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 168 - 239
Target Start/End: Original strand, 6526084 - 6526155
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| | || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
6526084 |
atattatatgcaggggctggagttcgaaccccggatactccacttctccacaattaaattgtgtgagctcta |
6526155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 10241743 - 10241825
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||| |||||| |||| || |||| | || |||||||||||||||| |
|
|
| T |
10241743 |
ttggtagggatattg-catattatatgcaggggttggggttcaaaccccagacactccacttctccagaatttaattgtgtgag |
10241825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 13621983 - 13621916
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
13621983 |
catattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgag |
13621916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 167 - 242
Target Start/End: Original strand, 36124432 - 36124507
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||| || |||| | |||||||||| |||||||| ||||||| |
|
|
| T |
36124432 |
catattatatgcaggggtcggggttcgaatcccggacactccacttctccacaatttaactgtgtgagctctaacc |
36124507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 168 - 242
Target Start/End: Complemental strand, 13876357 - 13876283
Alignment:
| Q |
168 |
atattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||| || | || | |||||||||| |||||||| ||||||| |
|
|
| T |
13876357 |
atattatatgcagcggccggggttcgaaccccggacactccatttctccacaatttaactgtgtgagctctaacc |
13876283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 241
Target Start/End: Complemental strand, 17175103 - 17175014
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||||||||| |||||| || |||| | ||||||| |||||||||| |||||| |
|
|
| T |
17175103 |
ttggtagggatattg-catgttatatgcaggggccggggttcgaacctcggacactccacttctccacaattatattgtgtgagatctaac |
17175014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 27765275 - 27765376
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||| ||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
27765275 |
ttggtagggatattg-catattatatgcaggaggcggggttcgaaccccgcacactccacttctccacaattaaattgtgtgagctctagccactaggct |
27765373 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
27765374 |
act |
27765376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 229
Target Start/End: Complemental strand, 35112999 - 35112937
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgt |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| ||||||| | ||||||| |||||| |
|
|
| T |
35112999 |
catattatatgcaggggttggggttcgaactccggacactctacttctccacaattaaattgt |
35112937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 150 - 239
Target Start/End: Complemental strand, 20707840 - 20707752
Alignment:
| Q |
150 |
tttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| |||| |||||||||||| ||||||||||||||| |||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
20707840 |
tttggtagggatattg-catactatatgcaggggttggggttcgaaccccagacacttcacttctccacaattaaattgtgtgagctcta |
20707752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 234
Target Start/End: Original strand, 988732 - 988814
Alignment:
| Q |
150 |
tttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||| ||| || |||| | ||||||| ||||||||||| |
|
|
| T |
988732 |
tttggtagggatattg-catattatatgcaggagctggggttcgaacccc-aacactccacttctccacaattaaattgtgtgag |
988814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 231
Target Start/End: Original strand, 2328610 - 2328689
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||||||| |||| || |||| | ||||||| |||||||| |
|
|
| T |
2328610 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtgt |
2328689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 11786112 - 11786025
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||| |||||||||||| ||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
11786112 |
ttggtagggatattg-cattttatatgcaggggctgaggttcgaaccccacacactccacttctccacaattaaattgtgtgagctcta |
11786025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 41179855 - 41179768
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||| |||||||| || |||| | |||| || ||||||||||| |||| |
|
|
| T |
41179855 |
ttggtagggatattg-catattatatgcaggagccggggttcgaatcccggacactccacttctccacatttaaattgtgtgagctcta |
41179768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 41319503 - 41319416
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| || |||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
41319503 |
ttggtagggatattg-cattttatatgcaggggtcggagttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
41319416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 253
Target Start/End: Complemental strand, 2301605 - 2301522
Alignment:
| Q |
170 |
attatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| || | || | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
2301605 |
attatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggctact |
2301522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 9688709 - 9688634
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| ||| | |||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
9688709 |
catattatatgcagaggtcggggttcgaaccccgaacactacacttcttcacaattaaattgtgtgagctctaacc |
9688634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 210
Target Start/End: Original strand, 39165035 - 39165093
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctac |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||| |||| ||||| |
|
|
| T |
39165035 |
ttggtagggatattg-catattatatgcaggagctggggttcgaaccccagacactctac |
39165093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 41477391 - 41477328
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| || |||| | |||||| ||||||||||| |
|
|
| T |
41477391 |
ttatatgcaggggctggggttcgaaccccgaacactccacttttcgacaattaaattgtgtgag |
41477328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 42916426 - 42916489
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
42916426 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgag |
42916489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 189 - 239
Target Start/End: Complemental strand, 6291888 - 6291838
Alignment:
| Q |
189 |
gttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| ||||||||||| |||| |
|
|
| T |
6291888 |
gttcgaaccccggacactctacttcttcacaattaaattgtgtgagctcta |
6291838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 8750953 - 8750853
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||| ||||||| | |||| | |||||||||||| || ||| ||||||| ||| ||| |
|
|
| T |
8750953 |
ttggtagggatattg-catattatatgcaggg-ctggggttcgaattccggacacttcacttctccacaatttaattatgagagctctaaccactaggct |
8750856 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
8750855 |
act |
8750853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 10404160 - 10404246
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||| || | || | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
10404160 |
catattatatgcaggagtcggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggctact |
10404246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 17064910 - 17064810
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||| |||||||||||| | |||| | |||| ||||||||||||||||||| || ||| ||| |
|
|
| T |
17064910 |
ttggtagggatattg-catattatatgcaggggccgacgtttgaaccccggacaccccacttctccaca-tttaattgtgtgagttctagccactaggct |
17064813 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
17064812 |
act |
17064810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 253
Target Start/End: Original strand, 29154895 - 29154961
Alignment:
| Q |
187 |
gggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||||||||||| || |||| | ||||||| |||||||||||||||| || ||| |||||| |
|
|
| T |
29154895 |
gggttcgaaccccggacactccacttctccacaattaaattgtgtgagttctagccactacgctact |
29154961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 4418395 - 4418342
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||| | ||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
4418395 |
ttggtagggataaatgcattttatatgcaggggctggggttcgaacctcggaca |
4418342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 252
Target Start/End: Original strand, 8241068 - 8241168
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| ||||||||||||||||||| | |||| | |||| || || |||||||| ||||||| ||| ||| |
|
|
| T |
8241068 |
ttggtagggatattg-catattatatgcaagggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctctaaccactaggct |
8241166 |
T |
 |
| Q |
251 |
ac |
252 |
Q |
| |
|
|| |
|
|
| T |
8241167 |
ac |
8241168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 171 - 252
Target Start/End: Complemental strand, 11146562 - 11146481
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctac |
252 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||| || |||| | |||| || ||||||||||| ||||||| ||| ||||| |
|
|
| T |
11146562 |
ttatatgtaggggttggagttcgaaccccggacactccacttctccacagttcaattgtgtgagctctaaccactaggctac |
11146481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 12891575 - 12891627
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
12891575 |
ttggtagggatattg-catattatatgtaggggccggggttcgaaccccggaca |
12891627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 232
Target Start/End: Original strand, 16603416 - 16603496
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtg |
232 |
Q |
| |
|
|||||||||||||| |||||||||||||| || ||| |||||||||| |||| ||||||| | ||||||| ||||||||| |
|
|
| T |
16603416 |
ttggtagggatattg-catattatatgcagaagccgggattcgaaccccagacactctacttctccacaattaaattgtgtg |
16603496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 170 - 239
Target Start/End: Complemental strand, 21962139 - 21962070
Alignment:
| Q |
170 |
attatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||| || || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
21962139 |
attatatgcgggagccggggttcgaaccccggacactccacttttccacaattaaattgtgtgagctcta |
21962070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 253
Target Start/End: Original strand, 33999090 - 33999179
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||| ||||||| ||||| |||||||||||||||||||| || | || | |||| || |||| ||||||||||| || ||| |||||| |
|
|
| T |
33999090 |
ttacattttatatgtaggggttggggttcgaaccccggacactccatttctccacagttaaattatgtgagttctagccactaggctact |
33999179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 236
Target Start/End: Original strand, 35241429 - 35241497
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagtt |
236 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| |||| || |||| | ||||||||||||||||||||| |
|
|
| T |
35241429 |
catattatatgcaggggtcggggttcgaa-ccctgacactccacttctccacaatttaattgtgtgagtt |
35241497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 39919145 - 39919093
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
39919145 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggaca |
39919093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 1743145 - 1743231
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||| ||||||||||||||| || |||| | |||||| ||||||||||| |||| |
|
|
| T |
1743145 |
ttggtagggatattg-catattatatgcaggagccggg-ttcgaaccccggacactccacttctctacaattaaattgtgtgagctcta |
1743231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 4153565 - 4153652
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| ||||||| | ||| |||||||||||| |||||| ||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
4153565 |
ttggtagggatattg-cattttatatgtatgggttggggttcgaacttcggacactctacttctccacaattaaattgtgtgagctcta |
4153652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 203
Target Start/End: Complemental strand, 4238345 - 4238309
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggac |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4238345 |
catattatatgcaggggccggggttcgaaccccggac |
4238309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 6414086 - 6414172
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | |||||||||| || |||||||| | || | ||||||| ||||||||||| |||| |
|
|
| T |
6414086 |
ttggtagggatattg-catattatatgcagggtc-ggggttcgaatcctggacattccatttctccacaattaaattgtgtgagctcta |
6414172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 7143432 - 7143518
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||||||||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
7143432 |
ttggtagggatattgt-atattatatgcacaggctggagttcgaaccccggacacctcacttcttcacaa-ttaattgtgtgagttcta |
7143518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 15241429 - 15241501
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
15241429 |
catattatatgcaggggtcggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctcta |
15241501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 19891459 - 19891391
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| ||||||||||| |||||| | || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
19891459 |
ttatatgcaggggttggggttcgaatcccggatactccacttctccacaattaaattgtgtgagctcta |
19891391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 25729473 - 25729405
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||||||||||||| |||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
25729473 |
ttatatgcaggggtcggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctcta |
25729405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 35512008 - 35511921
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||| |||| |||||||| ||||| ||||||||||||||||| | || |||| | |||||| ||||||||||| |||| |
|
|
| T |
35512008 |
ttggtagggatatc-acattttatatgctggggccggggttcgaaccccggaaactccacttctcgacaattaaattgtgtgagctcta |
35511921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 40276479 - 40276408
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| | |||| | ||||| |||||||||||||||||| |
|
|
| T |
40276479 |
catattatatgcaggggctgagattcgaaccccggacgccccacttctccacaa-ttaattgtgtgagttcta |
40276408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 41156361 - 41156433
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||||||| || |||| | ||||||| ||| ||||||| |||| |
|
|
| T |
41156361 |
catattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaatcgtgtgagctcta |
41156433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 41930142 - 41930210
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| | |||| | |||||| ||||||||||| |||| |
|
|
| T |
41930142 |
ttatatgcaggggctggggttcgaaccccagacaccccacttctctacaattaaattgtgtgagctcta |
41930210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 42320335 - 42320422
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | || |||||||||||| ||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
42320335 |
ttggtagggatattg-catattatatgcaggagtcggagttcgaaccccgaacactccacttctccacaattaaattgtgtgagctcta |
42320422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 1463903 - 1463938
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1463903 |
tattatatgcaggggccggggttcgaaccccggaca |
1463938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 187 - 242
Target Start/End: Complemental strand, 3712084 - 3712029
Alignment:
| Q |
187 |
gggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
||||||||||||| |||| | ||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
3712084 |
gggttcgaaccccagacactttacttgtccacaattaaattgtgtgagctctaacc |
3712029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 164 - 239
Target Start/End: Complemental strand, 8149076 - 8149001
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||| |||||||||| || ||||||||| || ||||| ||||||| | ||||||||||||||||||| |||| |
|
|
| T |
8149076 |
ttacatgttatatgcagaggtcagggttcgaaacctggacactctacttctccacaatttaattgtgtgagctcta |
8149001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 10943748 - 10943783
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10943748 |
tattatatgcaggggccggggttcgaaccccggaca |
10943783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 25648137 - 25648035
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaa-ccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgc |
249 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| || |||||||||| |||| |||| || |||| | ||||||| ||||||||||| |||| || ||| || |
|
|
| T |
25648137 |
ttggtagggatattg-catattacatgcaggagccggggttcgaacccccagacactccacttctccacaattaaattgtgtgagctctagccactaggc |
25648039 |
T |
 |
| Q |
250 |
tact |
253 |
Q |
| |
|
|||| |
|
|
| T |
25648038 |
tact |
25648035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 40091495 - 40091577
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||| | || | ||||||||| ||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
40091495 |
ttggtagggatattg-catattatatgcaagagccgaggttcgaactccggacactccacttctccacaattaaattgtgtgag |
40091577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 10905169 - 10905087
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| | |||| | ||||||||||||||| ||| |||| || ||| |||||| |
|
|
| T |
10905169 |
ttatatgcaggggtcggggttcgaaccctggacacttcacttctccacaatttaattgtgcgagctctagccactaggctact |
10905087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 28308252 - 28308353
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||| | || | ||||| ||||||| ||| || |||| | || |||||||||||||||| |||| || ||| ||| |
|
|
| T |
28308252 |
ttggtagggatattg-catattatatgcaagagccgaggttctaaccccgaacactccacttctgcataatttaattgtgtgagctctagccactaggct |
28308350 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
28308351 |
act |
28308353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 10758841 - 10758768
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgt-tcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| |||| || |||| | |||||||| ||||||||||| |||| |
|
|
| T |
10758841 |
catattatatgtaggggctggggtttaaaccccagacactccacttctctcacaattaaattgtgtgagctcta |
10758768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 188 - 253
Target Start/End: Original strand, 11795547 - 11795612
Alignment:
| Q |
188 |
ggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
11795547 |
ggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctact |
11795612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 17891892 - 17891859
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
17891892 |
ttatatgcaggggccggggttcgaaccccggaca |
17891859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 23937966 - 23937933
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
23937966 |
ttatatgcaggggccggggttcgaaccccggaca |
23937933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 30641540 - 30641593
Alignment:
| Q |
186 |
ggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||||||||||| |||| || | ||||||| ||||||||||| |||| |
|
|
| T |
30641540 |
ggggttcgaaccccggacactctatttctccacaattaaattgtgtgagctcta |
30641593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 38642249 - 38642197
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
38642249 |
ttggtaggaatatt-acatattatatgcagggattggagttcgaaccccggaca |
38642197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 40361631 - 40361579
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| |||||||||||| ||||||| |
|
|
| T |
40361631 |
ttggtagggatattg-catattatatgcaagggttggggttcgaactccggaca |
40361579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 218
Target Start/End: Complemental strand, 42455457 - 42455408
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| || |||| ||||| |
|
|
| T |
42455457 |
tattatatgcaggggccggagttcgaaccccggacactccacttattcac |
42455408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 203
Target Start/End: Original strand, 12767982 - 12768033
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggac |
203 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || || ||||||||||||||| |
|
|
| T |
12767982 |
ttggtagggatattg-catattatatgcaggagccggcgttcgaaccccggac |
12768033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 16280283 - 16280351
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||| || ||| | |||| || ||||||||||| |||| |
|
|
| T |
16280283 |
ttatatgtaggggttggggttcgaaccccggacactccactcctccacatttaaattgtgtgagctcta |
16280351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 16891364 - 16891451
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| |||||| |||||| || |||||||| |||| ||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
16891364 |
ttggtagggatattg-cattttatatacaggggttgaggttcgaatcccgaacactccacttctccacaattaaattgtgtgagctcta |
16891451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 18756023 - 18756091
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||||||| | ||||||||||||||||||| || | || | |||||| |||||||||||||||| |
|
|
| T |
18756023 |
ttatatgcaggagtcggggttcgaaccccggacactccatttctctacaattaaattgtgtgagttcta |
18756091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 23292469 - 23292383
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| ||||||||||||| |||||| | |||| | ||||| |||||||||||| ||||| |
|
|
| T |
23292469 |
ttggtagggatattg-catgttatatgcagggtttggggttcgaacctcggacaccccacttctccacaa-ttaattgtgtgaattcta |
23292383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 26065495 - 26065444
Alignment:
| Q |
145 |
aaatttttggtagggatatttacatattatatgcaggggctggggttcgaacc |
197 |
Q |
| |
|
|||| ||||| ||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
26065495 |
aaatatttggcagggatattg-catattatatgcaggggttggggttcgaacc |
26065444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 199
Target Start/End: Original strand, 26912851 - 26912898
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaacccc |
199 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
26912851 |
ttggtagggatattg-catattatatgtaggggccggggttcgaacccc |
26912898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 35015008 - 35015044
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccg |
200 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
35015008 |
ttacattttatatgcaggggttggggttcgaaccccg |
35015044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 204
Target Start/End: Complemental strand, 36716909 - 36716858
Alignment:
| Q |
152 |
tggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
||||||||||||| |||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
36716909 |
tggtagggatattg-catattatatgcagggaccggggtttgaaccccggaca |
36716858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 239
Target Start/End: Original strand, 38696713 - 38696794
Alignment:
| Q |
155 |
tagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||||||||||| ||||| || |||| ||||| |||||| |||||||| |||| |
|
|
| T |
38696713 |
tagggatatt-acatattatatgcaatggc-ggggttcgaaccctggacactccacttcttcac-atttaaatgtgtgagctcta |
38696794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 20245 - 20162
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| ||| |||||||| |||||| || |||| ||||||||||||||||||||| |
|
|
| T |
20245 |
ttggtagggatatttgcattttatatgcaggggtcgggtttcgaaccacggacactccacttcttcacaatttaattgtgtgag |
20162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 234
Target Start/End: Complemental strand, 16207 - 16148
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
|||||||||| | ||||||||||||| |||||| |||| ||||| ||||||||||||||| |
|
|
| T |
16207 |
tatgcaggggttagggttcgaaccccagacatttcacttcttcac-atttaattgtgtgag |
16148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 46544 - 46625
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| || ||| | |||||||||||||||||| |
|
|
| T |
46544 |
ttggtagggatattg-catattatatgcaggggctggggttcgaaccccagacactccactgctccacaatttaattgtgtga |
46625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 12012 - 12093
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtga |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||| |||||||||||| || |||| | ||||||| |||||||||| |
|
|
| T |
12012 |
ttggtagggatattg-catattatatgcaggagccggggtttgaaccccggacactccacttctccacaattaaattgtgtga |
12093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 10878 - 10777
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
10878 |
ttggtagggatattg-catattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggct |
10780 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
10779 |
act |
10777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 27982 - 27881
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| ||||||||| ||||||||| || |||| | ||||||| |||||||||||||||| || ||| ||| |
|
|
| T |
27982 |
ttggtagggatattg-cattttatatgcaggggccggggttcgatccccggacactccacttctccacaattaaattgtgtgagttctagccactaggct |
27884 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
27883 |
act |
27881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 11172 - 11085
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
11172 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
11085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 21500 - 21413
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
21500 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
21413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 59801 - 59888
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
59801 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
59888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 12477 - 12578
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||| |||||| |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
12477 |
ttggtagggatattg-catattatatgcaggaggcggggttcgaaccccgcacattccacttctccacaattaaattgtgtgagctctagccactaggct |
12575 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
12576 |
act |
12578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 13255 - 13203
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13255 |
ttggtagggatattg-catattatatgcaggggttggggttcgaaccccggaca |
13203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 4066 - 3965
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||||||||||| |||| || |||| | ||||||||||||||||||| |||| || ||| ||| |
|
|
| T |
4066 |
ttggtagggatattg-catattatatgcaggagtcggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggct |
3968 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
3967 |
act |
3965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Complemental strand, 912 - 811
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| || |||| | ||||||| ||||||| ||| |||| || ||| ||| |
|
|
| T |
912 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgcgagctctagccactaggct |
814 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
813 |
act |
811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 175 - 253
Target Start/End: Complemental strand, 17290 - 17212
Alignment:
| Q |
175 |
atgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||||||||| ||||||||||||||||||| || |||| ||||||||| ||||||||||| |||| || ||| |||||| |
|
|
| T |
17290 |
atgcaggggccggggttcgaaccccggacactccacttcttcacaattaaattgtgtgagctctagccactaggctact |
17212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 21282 - 21383
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||| |||||||||| ||||||| |||| | || |||||| ||||||||| |||| || ||| ||| |
|
|
| T |
21282 |
ttggtagggatattg-catattatatgcaggggttgggtttcgaaccccagacattccacttctccaaaatttatttgtgtgagctctagccactaggct |
21380 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
21381 |
act |
21383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 241
Target Start/End: Complemental strand, 50038 - 49964
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
||||||||||| ||||| | |||||||||| ||||||| ||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
50038 |
catattatatgtaggggttagggttcgaactccggacactctacttctccacaatttaattgtgtgagctctaac |
49964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 45928 - 46015
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||| |||||| | |||||||||||||||| ||||||||| |||| |||| || |||| | |||||||||||||||||||||||| |
|
|
| T |
45928 |
ttggtagagatatt-atatattatatgcaggggtcggggttcgagccccagacactccacttctccacaatttaattgtgtgagttcta |
46015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 3684 - 3785
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||||||||||||||| || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
3684 |
ttggtagggatattg-catattatatgcaggaaccagggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggct |
3782 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
3783 |
act |
3785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 8984 - 9085
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || || |||||||||||||| | || |||| | ||||||| ||||||||||| |||| || ||| ||| |
|
|
| T |
8984 |
ttggtagggatattg-catattatatgcaggagccggagttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactaggct |
9082 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
9083 |
act |
9085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 23379 - 23479
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgct |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| |||||||||| |||||||| || |||| | || |||| ||||||||||| ||||||| ||| ||| |
|
|
| T |
23379 |
ttggtagggatattg-catattatatgcagaggccggggttcgaa-cccggacactccacttctccataattaaattgtgtgagctctaaccactaggct |
23476 |
T |
 |
| Q |
251 |
act |
253 |
Q |
| |
|
||| |
|
|
| T |
23477 |
act |
23479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 241
Target Start/End: Original strand, 39664 - 39753
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaac |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||| |||| || | | |||| ||||||||| ||||||||||| |||||| |
|
|
| T |
39664 |
ttggtagggatattg-catattatatgcaggggttggggttcgagccccagataccccacttcttcacaattaaattgtgtgagctctaac |
39753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 25058 - 25093
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25058 |
tattatatgcaggggctggggttcgaaccccggaca |
25093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 18516 - 18444
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||| | |||| | ||||||| ||||||||||| |||| |
|
|
| T |
18516 |
catattatatacaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
18444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 242
Target Start/End: Original strand, 433 - 508
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacc |
242 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||| || |||| | |||||| |||||||||| ||||||| |
|
|
| T |
433 |
catattatatgcaggggccggggttcgaacctcggacactccacttctctacaattaaattgtgtgaactctaacc |
508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 253
Target Start/End: Original strand, 24420 - 24498
Alignment:
| Q |
174 |
tatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
||||||||||| ||||||||||||||||||| || |||| ||||| |||||| |||||||| |||| || ||| |||||| |
|
|
| T |
24420 |
tatgcaggggccggggttcgaaccccggacactccacttcttcac-atttaaatgtgtgagctctagccactaggctact |
24498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 1882 - 1934
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
1882 |
ttggtagggatattg-catattatatgcaggggccgaggttcgaaccccggaca |
1934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 154 - 227
Target Start/End: Complemental strand, 1775 - 1703
Alignment:
| Q |
154 |
gtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaatt |
227 |
Q |
| |
|
||||||||||| |||||||||||| | ||| |||||||||||||||||||| || |||| | ||||||| |||| |
|
|
| T |
1775 |
gtagggatatt-acatattatatgtaagggttggggttcgaaccccggacactccacttctccacaattaaatt |
1703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 234
Target Start/End: Complemental strand, 28861 - 28792
Alignment:
| Q |
164 |
ttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgag |
234 |
Q |
| |
|
||||||| | ||||||||||| ||||||||||||||||||| | |||| | ||| ||||||||||||||| |
|
|
| T |
28861 |
ttacatactttatgcaggggccggggttcgaaccccggacaccccacttctccac-atttaattgtgtgag |
28792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 236
Target Start/End: Original strand, 56356 - 56425
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagtt |
236 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||| | | || | ||||||| ||||||||||||| |
|
|
| T |
56356 |
catattatatgcaggggccggggttcgaaccccagacacttcatttctccacaattaaattgtgtgagtt |
56425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 66625 - 66588
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
66625 |
catattatatgcaggggccggggttcgaaccccggaca |
66588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Original strand, 204 - 276
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| | |||| | |||||||||||||| |||| |||| |
|
|
| T |
204 |
catattatatgcaggggccggggttcgaaccccaaacacttcacttctccacaatttaattgtatgagctcta |
276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 239
Target Start/End: Complemental strand, 117 - 45
Alignment:
| Q |
167 |
catattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| | |||| | |||||||||||||| |||| |||| |
|
|
| T |
117 |
catattatatgcaggggccggggttcgaaccccaaacacttcacttctccacaatttaattgtatgagctcta |
45 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 15782 - 15869
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | | ||||||||||||||| | || |||| | ||||||| ||||||||||| |||| |
|
|
| T |
15782 |
ttggtagggatattg-catattatatgcaggagtcgaggttcgaaccccggatactccacttctccacaattaaattgtgtgagctcta |
15869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 231
Target Start/End: Complemental strand, 8877 - 8798
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgt |
231 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||| |||| | |||||||||||| || | || | |||||||||||||||| |
|
|
| T |
8877 |
ttggtagggatattg-catattttatgcaggggccgggggttgaaccccggacactccatttctccacaatttaattgtgt |
8798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 222
Target Start/End: Complemental strand, 72 - 2
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatt |
222 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||| ||||| || |||| | ||||||| |
|
|
| T |
72 |
ttggtagggatattg-catattatatgcaggagccggggttcgaaccctggacactccacttctccacaatt |
2 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 7108 - 7143
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7108 |
tattatatgcaggggccggggttcgaaccccggaca |
7143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 6696 - 6661
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggaca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6696 |
tattatatgcaggggccggggttcgaaccccggaca |
6661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0112 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0112
Description:
Target: scaffold0112; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 171 - 218
Target Start/End: Complemental strand, 17992 - 17945
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| || |||| ||||| |
|
|
| T |
17992 |
ttatatgcaggggctggggttcgaaccccagacactccacttattcac |
17945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 218
Target Start/End: Original strand, 4355 - 4404
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacattctacttgttcac |
218 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| || |||| ||||| |
|
|
| T |
4355 |
tattatatgcaggggtcggggttcgaaccccggacactccacttattcac |
4404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0276 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 1297 - 1365
Alignment:
| Q |
171 |
ttatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
||||||| |||||| ||||||| |||| |||||| || |||| | |||||||||||| |||||| |||| |
|
|
| T |
1297 |
ttatatgtaggggccggggttcaaacctcggacactccacttctccacaatttaattatgtgagctcta |
1365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 8839 - 8925
Alignment:
| Q |
151 |
ttggtagggatatttacatattatatgcaggggctggggttcgaaccccggacattctacttgttcacaatttaattgtgtgagttcta |
239 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| | ||||||||||||||| ||| || | || | ||||||| ||||||||||| |||| |
|
|
| T |
8839 |
ttggtagggatattg-cattttatatgcagggtc-ggggttcgaaccccgaacaatccatttctccacaattaaattgtgtgagctcta |
8925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 253
Target Start/End: Original strand, 6052 - 6096
Alignment:
| Q |
209 |
acttgttcacaatttaattgtgtgagttctaacccctatgctact |
253 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||| ||| |||||| |
|
|
| T |
6052 |
acttcttcacaatttaattgtgtgagctctaaccactaggctact |
6096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 205
Target Start/End: Complemental strand, 7081 - 7045
Alignment:
| Q |
169 |
tattatatgcaggggctggggttcgaaccccggacat |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
7081 |
tattatatgcaggggcgggggttcgaaccccgtacat |
7045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 205
Target Start/End: Original strand, 22487 - 22527
Alignment:
| Q |
165 |
tacatattatatgcaggggctggggttcgaaccccggacat |
205 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| ||||| |
|
|
| T |
22487 |
tacatattatatgtaggggctgaggttcgaaccccagacat |
22527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University