View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6239_high_17 (Length: 236)

Name: NF6239_high_17
Description: NF6239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6239_high_17
NF6239_high_17
[»] chr5 (1 HSPs)
chr5 (16-164)||(34923720-34923864)


Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 16 - 164
Target Start/End: Original strand, 34923720 - 34923864
Alignment:
16 ataatagtaatttgtactataaacttataaactagtatatgtattttcttaacacaatcaatagcatcaaactagcatgtgtattttcaaaattttctca 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||    
34923720 ataatagtaatttgtactataaacttataaactagtatatgtattttcttaacacaat----agcatcaaactagcatgtgtattttcaaaattttctca 34923815  T
116 tattaacattttcaaaaaccgaaccgaactacattgttcaaccggttga 164  Q
    ||||||||| || ||||||||||||||||| ||||||||||||||||||    
34923816 tattaacatctttaaaaaccgaaccgaactgcattgttcaaccggttga 34923864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University