View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6239_high_8 (Length: 297)
Name: NF6239_high_8
Description: NF6239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6239_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 16 - 286
Target Start/End: Original strand, 54264045 - 54264314
Alignment:
| Q |
16 |
tcatctacagatgtggtaggctgagttttctagcaatgtgtggaagtttggcttgcaaaggtgtgatccgttgtttcctgcggagttgggttgcttgcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54264045 |
tcatctacagatgtggtaggctgagttttctagcaatatgtgggagtttggcttgcaaaggtgtgatccgttgtttcctgcggagttgggttgcttgcat |
54264144 |
T |
 |
| Q |
116 |
gcagagtggaagtggtggctaaagggatatcggtctgattgcttattggttttcattttgtggagggttgagtagtagtttgtgagggggtgggcttttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54264145 |
gcagagtggaagtggtggctaaagggatatcggtctgattgctta-tggttttcattttgtggagggttgagtagtagtttgtgagggggtgggcttttt |
54264243 |
T |
 |
| Q |
216 |
gtcctttgctgaggtgtatccttatgtatgttattactcagatcacagnnnnnnnacattttctgtcctat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54264244 |
gtcctttgctgaggtgtatccttatgtatgttattactcagatcacagtttttttacattttctgtcctat |
54264314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University