View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6239_high_9 (Length: 288)
Name: NF6239_high_9
Description: NF6239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6239_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 114 - 270
Target Start/End: Complemental strand, 40736919 - 40736763
Alignment:
| Q |
114 |
catatgattcggctatatgatggagagaccctcgagtttaatgctttgtgtgctcaaattgagtttctgattcatagaaacatatgaaaacggacatctg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736919 |
catatgattcggctatatgatggagagaccctcgagtttaatgctttgtgtgctcaaattgagtttctgattcatagaaacatatgaaaacggacatctg |
40736820 |
T |
|
| Q |
214 |
caattcaattcattgaatttctctatccataaagttggggacattctttaccagttt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736819 |
caattcaattcattgaatttctctatccataaagttggggacattctttaccagttt |
40736763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 40737017 - 40736988
Alignment:
| Q |
19 |
tgaaagaaaagtaggataagtcttttctat |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40737017 |
tgaaagaaaagtaggataagtcttttctat |
40736988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University