View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6239_low_11 (Length: 280)
Name: NF6239_low_11
Description: NF6239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6239_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 113 - 256
Target Start/End: Original strand, 17355838 - 17355981
Alignment:
| Q |
113 |
tcatatttgttttttgggcttatgtttcttgattttcttttaagaaagaacaagatcttgtattggtatggctaccattacaaatcttgtgggtcatatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
17355838 |
tcatatttgttttttgggcttatgtttcttgattttcttttaagaaagaacaagatcttgtattggtatggctaccattacaaatcttatgggtcttatc |
17355937 |
T |
|
| Q |
213 |
tttcatttcttgatcaattgtcgtgaatcgttgattagatcgaa |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17355938 |
tttcatttcttgatcaattgtcgtgaatcgttgattagatcgaa |
17355981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 54
Target Start/End: Original strand, 17355768 - 17355818
Alignment:
| Q |
4 |
gatggacatcatcatcatgaaccccttcttcttcatattttcatcatctta |
54 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17355768 |
gatggacatcttcatcatgaacctcttcttcttcatattttcatcatctta |
17355818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University