View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6239_low_24 (Length: 204)
Name: NF6239_low_24
Description: NF6239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6239_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 83 - 194
Target Start/End: Original strand, 40737284 - 40737395
Alignment:
| Q |
83 |
tcaagattttatgtgggtgctagaaaagacattgacctgccgtaaatttcagcccaaaagaaaattctttgcggttatcaatagttgtcatttgatattt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40737284 |
tcaagattttatgtgggtgctagaaaagacattgacctgccgtaaatttcagcccaaaagaaaattctttgcggttatcaatagttgtcatttgatattt |
40737383 |
T |
 |
| Q |
183 |
caatgtgatgat |
194 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40737384 |
caatgtgatgat |
40737395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University