View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6239_low_4 (Length: 355)
Name: NF6239_low_4
Description: NF6239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6239_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 131 - 341
Target Start/End: Complemental strand, 692618 - 692408
Alignment:
| Q |
131 |
gtattgtagaatctgacgtggaattgttagaacgttgcatttgcatgtgactgagtagttagatttgtaacgtgcttttggatttttgctcgggaaagtg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
692618 |
gtattgtagaatctgacgtggaattgttagaacgttgcatttgcatgtgactgagtagttagatttgtaacgtgcttttggatttttgctcgggaaagtg |
692519 |
T |
 |
| Q |
231 |
gaaaaactttttctgactgnnnnnnnattgcattggaaaatttgaaatcttgttgtgtctgtgtaataatattttagaatttagtttgtaatattaagag |
330 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
692518 |
gaaaaactttttctgactgtttttttattgcattggaaaatttgaaatcttgttgtgtctgtgtaataatattttagaatttagtttgtaatattaagag |
692419 |
T |
 |
| Q |
331 |
tgacgttgatg |
341 |
Q |
| |
|
||||||||||| |
|
|
| T |
692418 |
tgacgttgatg |
692408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 17 - 89
Target Start/End: Complemental strand, 692732 - 692660
Alignment:
| Q |
17 |
acaaagataatgcgttagtttcttaatctatgttttttgttttcgttaattaaccaacaatcatgttaatgtt |
89 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
692732 |
acaaagaccatgcgttagtttcttaatctatgttttttgttttcgttaattaaccaacaatcatgttaatgtt |
692660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University