View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6240_high_15 (Length: 316)
Name: NF6240_high_15
Description: NF6240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6240_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 16 - 299
Target Start/End: Original strand, 7806234 - 7806517
Alignment:
| Q |
16 |
tcttcttcaaagttacttgcttccttccaaagcctattccttcagccccagatccaaattttaaacatcatatattagtctaatttctgcatgcaaaacg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7806234 |
tcttcttcaaagttacttgcttccttccaaagcctattccttcagcccctgatccaaattttaaacatcatttattagtctaatttctgcatgcaaaacg |
7806333 |
T |
 |
| Q |
116 |
tcaatttctaccaaaatggaaaaatggaatttttagagtaaaaatgggggcaattttgtgccagcccatggaaagagagaggaagggatatctcacttac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7806334 |
tcaatttctaccaaaatggaaaaatggaatttttagagtaaaaatgggggcaattttgtgccagcccatggaaagagagaggaagggatttctcacttac |
7806433 |
T |
 |
| Q |
216 |
ttcttgttccttttaagctaaattgatggactttatagaagatttgaacatgaaagcttctagggattaaaaaatggagaattt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7806434 |
ttcttgttccttttaagctaaattgatggacttgatagaagatttgaacatgaaagcttctagagattaaaaaatggagaattt |
7806517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University