View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6240_high_22 (Length: 239)
Name: NF6240_high_22
Description: NF6240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6240_high_22 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 239
Target Start/End: Original strand, 50667317 - 50667545
Alignment:
| Q |
11 |
catcatcaacggaaggtcgtgtctttgttcaaggaccggtgatcgtaggagcaggaccttctggtttggcagcagctgcatgtctacaacnnnnnnncat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
50667317 |
catcatcaacggaaggtcgtgtctttgttcaaggaccggtgatcgtaggagcaggaccttctggtttagcagcagctgcatgtctacaacaaaaaaacat |
50667416 |
T |
 |
| Q |
111 |
tccatgtgtaatactagaaagatctgattgtgtggcttcattatggcaactcaaaacctacgatcgattacgtcttcatcttccaaaacaattctgtgaa |
210 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50667417 |
tccatgtgtaatactagaaagatctaattgtgtggcttcattatggcaactcaaaacctacgatcgattgcgtcttcatcttccaaaacaattctgtgaa |
50667516 |
T |
 |
| Q |
211 |
ttaccctttatggaattcccctctaattt |
239 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
50667517 |
ttaccctttatggaattcccctcaaattt |
50667545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 230
Target Start/End: Complemental strand, 888903 - 888783
Alignment:
| Q |
110 |
ttccatgtgtaatactagaaagatctgattgtgtggcttcattatggcaactcaaaacctacgatcgattacgtcttcatcttccaaaacaattctgtga |
209 |
Q |
| |
|
||||| || |||||||||||||||| ||||| | |||||| ||||| | || |||||||||||||| | ||||||||| | ||||||||| | ||||| |
|
|
| T |
888903 |
ttccaagtttaatactagaaagatcaaattgtatagcttcactatggaagctaaaaacctacgatcgtcttcgtcttcatttaccaaaacaagtttgtga |
888804 |
T |
 |
| Q |
210 |
attaccctttatggaattccc |
230 |
Q |
| |
|
| || || ||||||||||| |
|
|
| T |
888803 |
gcttcctttaatggaattccc |
888783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 203
Target Start/End: Original strand, 32789638 - 32789714
Alignment:
| Q |
127 |
gaaagatctgattgtgtggcttcattatggcaactcaaaacctacgatcgattacgtcttcatcttccaaaacaatt |
203 |
Q |
| |
|
|||||| || ||||| | |||||| | |||||||||||||| || ||| ||||| | |||||||||||||| ||||| |
|
|
| T |
32789638 |
gaaagagctaattgtttagcttcaatgtggcaactcaaaacttatgatagattaaggcttcatcttccaaagcaatt |
32789714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University