View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6240_low_23 (Length: 239)

Name: NF6240_low_23
Description: NF6240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6240_low_23
NF6240_low_23
[»] chr3 (1 HSPs)
chr3 (11-239)||(50667317-50667545)
[»] chr1 (1 HSPs)
chr1 (110-230)||(888783-888903)
[»] chr6 (1 HSPs)
chr6 (127-203)||(32789638-32789714)


Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 239
Target Start/End: Original strand, 50667317 - 50667545
Alignment:
11 catcatcaacggaaggtcgtgtctttgttcaaggaccggtgatcgtaggagcaggaccttctggtttggcagcagctgcatgtctacaacnnnnnnncat 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||       |||    
50667317 catcatcaacggaaggtcgtgtctttgttcaaggaccggtgatcgtaggagcaggaccttctggtttagcagcagctgcatgtctacaacaaaaaaacat 50667416  T
111 tccatgtgtaatactagaaagatctgattgtgtggcttcattatggcaactcaaaacctacgatcgattacgtcttcatcttccaaaacaattctgtgaa 210  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
50667417 tccatgtgtaatactagaaagatctaattgtgtggcttcattatggcaactcaaaacctacgatcgattgcgtcttcatcttccaaaacaattctgtgaa 50667516  T
211 ttaccctttatggaattcccctctaattt 239  Q
    ||||||||||||||||||||||| |||||    
50667517 ttaccctttatggaattcccctcaaattt 50667545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 230
Target Start/End: Complemental strand, 888903 - 888783
Alignment:
110 ttccatgtgtaatactagaaagatctgattgtgtggcttcattatggcaactcaaaacctacgatcgattacgtcttcatcttccaaaacaattctgtga 209  Q
    ||||| || ||||||||||||||||  ||||| | |||||| ||||| | || ||||||||||||||  | ||||||||| | ||||||||| | |||||    
888903 ttccaagtttaatactagaaagatcaaattgtatagcttcactatggaagctaaaaacctacgatcgtcttcgtcttcatttaccaaaacaagtttgtga 888804  T
210 attaccctttatggaattccc 230  Q
      | || || |||||||||||    
888803 gcttcctttaatggaattccc 888783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 203
Target Start/End: Original strand, 32789638 - 32789714
Alignment:
127 gaaagatctgattgtgtggcttcattatggcaactcaaaacctacgatcgattacgtcttcatcttccaaaacaatt 203  Q
    |||||| || ||||| | |||||| | |||||||||||||| || ||| ||||| | |||||||||||||| |||||    
32789638 gaaagagctaattgtttagcttcaatgtggcaactcaaaacttatgatagattaaggcttcatcttccaaagcaatt 32789714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University