View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6240_low_26 (Length: 237)
Name: NF6240_low_26
Description: NF6240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6240_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 54477759 - 54477974
Alignment:
| Q |
1 |
tgcagtctttttgagaaaacaaatttaaaaaatgaattaaacaaatagcatttctgcttctgagcagaaccatatattcttttaaaagtcgaatgttgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | || | ||||| |
|
|
| T |
54477759 |
tgcagtctttttgagaaaacaaatttaaaaaatgaattaaacaaatagcatttctgcttctgagcagaaccatatat-------atattctttt-ttgaa |
54477850 |
T |
|
| Q |
101 |
tttgtttggaatgcaactnnnnnnn-ctgaagttttacaggttctaagtacaagtgtcacattttcatacttcttcatgatcttctaaaatgccgagaga |
199 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54477851 |
tttgtttggaatgcaactaaaaaaaactgaagttttacaggttctaagtacaagtgtcacattttcatacttcttcatgatcttgtaaaatgccgagaga |
54477950 |
T |
|
| Q |
200 |
tcattaaggaattatgtgtaactt |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
54477951 |
tcattaaggaattatgtgtaactt |
54477974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University