View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6240_low_28 (Length: 234)
Name: NF6240_low_28
Description: NF6240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6240_low_28 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 24 - 234
Target Start/End: Original strand, 30964668 - 30964879
Alignment:
| Q |
24 |
ttctgcaagcaaacaatattacctgatgggaaatttaaatagaaaaacatattcacacttcaaaggacatgctcgtccnnnnnnn-ggattgaactaatt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
30964668 |
ttctgcaagcaaacaatattacctgatgggaaatttaaatagaaaaacatattcacacttcaaaggacatgcccgtcccaaaaaaaggattgaactaatt |
30964767 |
T |
|
| Q |
123 |
caacctcaagaagaagcatgtttgtgttaaatgcaatgtcaagagaataaaacaaagctgtgtgtttccttgcttatccagctcaaattaaggcaaacat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30964768 |
caacctcaagaagaagcatgtttgtgttaaatgcaatgtcaagagaataaaacaaagctgtgtgtttccttgcttatccagctcaaattaaggcaaacat |
30964867 |
T |
|
| Q |
223 |
gaagacttagtt |
234 |
Q |
| |
|
||| |||||||| |
|
|
| T |
30964868 |
gaatacttagtt |
30964879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University