View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6240_low_30 (Length: 222)
Name: NF6240_low_30
Description: NF6240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6240_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 45 - 118
Target Start/End: Original strand, 2065171 - 2065244
Alignment:
| Q |
45 |
tgttgtgcatgaaaatgttttaagtgtaattttgttttggtttgagaaaataggataggagagggagagggcac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2065171 |
tgttgtgcatgaaaatgttttaagtgtaattttgttttggtttgagaaaataggataggagagggagagggcac |
2065244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 130 - 203
Target Start/End: Complemental strand, 25581628 - 25581555
Alignment:
| Q |
130 |
gttcaccattaatttacaaccaccccattgtacattccccattttctctctctaaaccctcgtgtcctttcccc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25581628 |
gttcaccattaatttacaaccaccccattgtacattccccattttctctctctaaaccctcgtgtcctttcccc |
25581555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University