View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6241_low_3 (Length: 279)
Name: NF6241_low_3
Description: NF6241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6241_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 14396427 - 14396664
Alignment:
| Q |
18 |
atttggagtacttgatcagcagcagcacatgcaagcaaacatctatggaagatatcagaagttagtatttcatgtagtgtttcgggctccttcttcttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
14396427 |
atttggagtacttgatcagcagcagcacatgcaagcaaacatctatggaagatatcagaagttagtatttcatgtattgtttcgggctccttcttctcgg |
14396526 |
T |
|
| Q |
118 |
ctcggcacacacattccaatactgtatggtataatataaagtaagtgtactaaatcttcgaatctttctatccggccaattatcaggaaatatagtctgc |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14396527 |
ctcggcacacacattccaatact-----gtatagtataaagtaagtgtattaaatcttcgaatctttctatccggccaattatcaggaaatatagtctgc |
14396621 |
T |
|
| Q |
218 |
actatactatgtgctctgaaactcaaaacatctgtaacatcctcgccc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14396622 |
-----actatgtgctctgaaactcaaaacatctgtaacatcctcgccc |
14396664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University