View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6242_low_6 (Length: 206)
Name: NF6242_low_6
Description: NF6242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6242_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 14 - 191
Target Start/End: Original strand, 18254269 - 18254446
Alignment:
| Q |
14 |
agcaaaggtcacagccgtataccaatctactctggaaaacaaacaaatattattggtcttatcttggtaatccttcaagtagatatatttttgttctagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18254269 |
agcaaaggtcacagccgtataccaatcttctctggaaaacaaacaaatattattggtcttatcctggtaatccttcaagtagatatatttttgttctagt |
18254368 |
T |
 |
| Q |
114 |
ttataacaatttctgattggaccctctgaataggctcatattggacgagataagacatggaaaaatgtgttcataggt |
191 |
Q |
| |
|
| ||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18254369 |
tgataacaatttctgtttggaccctcttaatagtctcatattggacgagataagacatggaaaaatgtgtttataggt |
18254446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University