View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6243_low_3 (Length: 260)
Name: NF6243_low_3
Description: NF6243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6243_low_3 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 25 - 260
Target Start/End: Original strand, 43017059 - 43017290
Alignment:
| Q |
25 |
cacagacaacggacacaacaaagacactaacatgttgaaacaattaattctacacctgcataatcgagttcatctcctctaaatgtgaaacaaaacatgg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017059 |
cacagacaacggacacaacaaagacactaacatgttgaaacaattaattctacacctgcataatcgagttcatctcctctaaatgtgaaacaaaacatgg |
43017158 |
T |
|
| Q |
125 |
actaattaatacttccgatgattaaatatatgattggggaggtctaccaaaacaacattgaccttatcaccttgaaatcctcgttccactactctttaaa |
224 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017159 |
actaat----acttccgatgattaaatatatgattggggaggtctaccaaaacaacattgaccttatcaccttgaaatcctcgttccactactctttaaa |
43017254 |
T |
|
| Q |
225 |
ccctacaaactttaccctcccaatcctcgctccacc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017255 |
ccctacaaactttaccctcccaatcctcgctccacc |
43017290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University