View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6244_high_11 (Length: 326)

Name: NF6244_high_11
Description: NF6244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6244_high_11
NF6244_high_11
[»] chr1 (1 HSPs)
chr1 (131-310)||(28425698-28425870)
[»] chr7 (1 HSPs)
chr7 (130-185)||(2955883-2955940)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 131 - 310
Target Start/End: Original strand, 28425698 - 28425870
Alignment:
131 ccgctttgcagatctagcttctcatgctttgagctgccagcaacccatatattaactatagagtttacttgctttgattctcagctctagttattctcta 230  Q
    |||||||||| ||||| ||||||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |    
28425698 ccgctttgca-atctaacttctcatgttttgagctgccaacaacccatatattgactatagagtttacttgctttgattctcagctctagttattctcca 28425796  T
231 tcgctatatatgtaatgggattcccatcgtattgccatgtctatgacatatatgtatattttgattccaatacattattt 310  Q
    |||||||||||||||| |||||||||||||||||| ||||||||||||      ||||||||||||||||||||||||||    
28425797 tcgctatatatgtaattggattcccatcgtattgctatgtctatgaca------tatattttgattccaatacattattt 28425870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 130 - 185
Target Start/End: Complemental strand, 2955940 - 2955883
Alignment:
130 accgctttgcagatctagcttctcatgctttgagctgccag--caacccatatattaa 185  Q
    ||||||||||||||||| |||||||||  ||||||||||||   ||||||||||||||    
2955940 accgctttgcagatctaacttctcatgtcttgagctgccagtataacccatatattaa 2955883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University