View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6244_high_9 (Length: 359)
Name: NF6244_high_9
Description: NF6244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6244_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 212 - 305
Target Start/End: Original strand, 30726920 - 30727013
Alignment:
| Q |
212 |
ctactaggcaaacaattttagtggagtaatcaaatgaatatcactgtttaagttttccaagtgattaaagttctagaatcatatgctccaaaaa |
305 |
Q |
| |
|
||||| || ||||| ||||||||| ||||||||||| | ||| ||||||||||||||||||||||||| | | |||||||||| ||| |||| |
|
|
| T |
30726920 |
ctactgggaaaacagttttagtggcgtaatcaaatggacatcgatgtttaagttttccaagtgattaaattcttggaatcatatgatcctaaaa |
30727013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 84 - 118
Target Start/End: Complemental strand, 501673 - 501639
Alignment:
| Q |
84 |
gggaaattattttgtaattcttgttttttacattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
501673 |
gggaaattattttgtaattcttgttttttacattt |
501639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 115 - 146
Target Start/End: Complemental strand, 501566 - 501535
Alignment:
| Q |
115 |
attttgtatttcaaacttgtcaccttgagcta |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
501566 |
attttgtatttcaaacttgtcaccttgagcta |
501535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University