View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6244_low_13 (Length: 298)
Name: NF6244_low_13
Description: NF6244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6244_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 26914319 - 26914181
Alignment:
| Q |
1 |
aattaaaaggacacattttattgttttgtacatggcataaannnnnnnagggtcgaccctgcctatattatcttatatcaaactgacaagaattgtttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26914319 |
aattaaaaggacacattttattgtttcgtacatggcataaaattttttagggtagaccctgcctatattatcttatatcaaactgacaagaattgtttgc |
26914220 |
T |
 |
| Q |
101 |
agtaagattaagaatttaggaatcatatttttccacaag |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26914219 |
agtaagattaagaatttaggaatcatatttttccacaag |
26914181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University