View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6244_low_14 (Length: 265)
Name: NF6244_low_14
Description: NF6244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6244_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 42995499 - 42995305
Alignment:
| Q |
1 |
atcctatttgtgagatagagaaggttgtcaacaagttacgaatgaagtacaagacatacatagttgagtatgtcgtcgaagatgtgggtagtccttcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42995499 |
atcctatttgtgagatagagaaggctatcaacaagttacgaatgaagtacaagacatacatatttgagtatgtcgtcgaagatgtgggtagtccttcctc |
42995400 |
T |
|
| Q |
101 |
atgttgccgtcgtttcatcctagggttttattattactgttattggcaattagatatctgaaatttggtgtcatgcttcagagttagatgatgga |
195 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
42995399 |
atgttgccatcgtttcatcctagggttttattgttactgttattggcaattagatatctgaaatttggtggcatgcttcagagttagaggatgga |
42995305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University