View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6244_low_7 (Length: 383)
Name: NF6244_low_7
Description: NF6244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6244_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 11 - 367
Target Start/End: Original strand, 43666542 - 43666904
Alignment:
| Q |
11 |
caaaggaagcagtagcatacatgtttttgtttaaggtgttaatgtgtttgagcttaattttgatttttgaggttggttgcactaaggggatttgtatatt |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43666542 |
caaaggaagtagtagcatacatgtttttgtttaaggtgttaatgtttttgagcttaattttgatttttgaggttggttgcactaaggggatttgtatatt |
43666641 |
T |
 |
| Q |
111 |
tataaggtggttggatttgttgtctttctctgattgtggcatgaaattacaattatcaattattatataa------taatgtgttaaatagtgtagctat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
43666642 |
tataaggtggttggatttgttgtctttctcttattgtggcatgaaattacaattatcaattattatataataataataatgtgctaaatagtgtagctat |
43666741 |
T |
 |
| Q |
205 |
aggtagctttgtaatcagaatattcctagaaggttatggttagatatagggtatttttctgtctttaatgttgttaccccttggagatagatgtcttcat |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43666742 |
aggtagctttgtaatcagaatattcctagaaggttatggttagatatagggtatttttctgtctttaatgttgttaccccttggagatagatgtcttcat |
43666841 |
T |
 |
| Q |
305 |
ttacaagtatatggatactccactaatttaaccttttgtaaattgcctttcaaatcaagatgg |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43666842 |
ttacaagtatatggatactccactaatttaaccttttgtaaattgcctttcaaatcaagatgg |
43666904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University