View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6247_high_9 (Length: 228)
Name: NF6247_high_9
Description: NF6247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6247_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 27 - 212
Target Start/End: Complemental strand, 26869275 - 26869089
Alignment:
| Q |
27 |
gtgcaagatgacgttctgttggttgatactttagttaatcatcttcatgctgaatggtctaaaggagctaataatgataattgtcagtaacagaagaagg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||| |||| ||||| ||| |
|
|
| T |
26869275 |
gtgcaagatgacgttctgttggttgatactttagttaaccatcttcatgctgaatggtctagaggagttaataatgataattgtcggtaatagaaggagg |
26869176 |
T |
 |
| Q |
127 |
ataaattctttattttgtctagatgtagttttgtagttctcttcctttcttgtgttgttttgacacg-ttttactgttgacggtttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
26869175 |
ataaattctttattttgtctagatgtagttttgtagttctcttcctttcttgtgttgttttgacacgtttttactgttgatggtttg |
26869089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University