View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6247_low_8 (Length: 252)
Name: NF6247_low_8
Description: NF6247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6247_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 2 - 222
Target Start/End: Complemental strand, 40208007 - 40207784
Alignment:
| Q |
2 |
aatattgttcaaagttccatttcttc---ttgaatttatcgtcctattgtcagttatttgattgcttgttactctatatgatctatgatatgtcaatatt |
98 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40208007 |
aatattgttcaaagttccatttctgcagcttgaatttatcgtcctattgtcagttatttgattgcttgttactctatatgatctatgatatgtcaatatt |
40207908 |
T |
 |
| Q |
99 |
gtatacaaggggtgaacataatgctgattcatcagtagatcttgttggatttctagccaaatactctcaatggcctgtagtaacattgggtcctaattgg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40207907 |
gtatacaaggggtgaacataatgctgattcatcagtagatgttgttggatttctagccaaatactctcaatggcctgcagtaacattgggtcctaattgg |
40207808 |
T |
 |
| Q |
199 |
tgcatgattaaacatagaatcgag |
222 |
Q |
| |
|
||| | ||||||||||||||||| |
|
|
| T |
40207807 |
tgctaggttaaacatagaatcgag |
40207784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University