View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6248_high_11 (Length: 302)
Name: NF6248_high_11
Description: NF6248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6248_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 37463741 - 37464023
Alignment:
| Q |
1 |
tatcgtggtttaaggtatcaacagggtgcacgtaggtacaaaagggaggcatacttctctgtgaatgatacaacaacgtccacacacatgatattcatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37463741 |
tatcgtggtttaaggtatcaacagggtgcacgtaggtacaaaagggaggcatacttctctctgaatgatacaacaacgtccacacgcatgatattcatgg |
37463840 |
T |
|
| Q |
101 |
aagagggaggtctgttgtgcgacgggggagataagacaaacgcaaaattgattcgtgaatgcatagtgctcagatgaatggcaatgaacaatcatcaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
37463841 |
aagagggaggtctgttgtgcgacgggggagattggacaaacgtaaaattgattcgtgaatgcaaagtgctcggatgaatggcaaggaacaatcatcaaat |
37463940 |
T |
|
| Q |
201 |
gtggcagtgactacgatggcctccttttactctactaattttctagaaaaaatttcttatgttaagttacgaaagggttttat |
283 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
37463941 |
gtggcagtgactacaatggcctccttttactctactaattttctagaaaaaacttcttatgttaagttacgaaaggattttat |
37464023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University