View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6248_high_15 (Length: 263)
Name: NF6248_high_15
Description: NF6248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6248_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 23279833 - 23280085
Alignment:
| Q |
1 |
taagctttttggttgtctctgttaccctcatattcctctatctagaaataaattatagtctcgctcaaccccatgtgtatttttgggttatccttcaaat |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||| |
|
|
| T |
23279833 |
taagctttttggttgtctatgttaccctcatattcctctatctaaaaataaattatagtctcgctcaaccacatatgtatttttgggttatccttccaat |
23279932 |
T |
 |
| Q |
101 |
cgtaaaagttataaatgtcatgagttgttgagtcataaaacaattatttctaggaatgtcacatttgataaaaatatgttttggttatcaactatgaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23279933 |
cgtaaaagttataaatgtcatgagttgtcgagtcataatacaattatttctaggaatgtcacatttgatgaaaatatgttttggttatcaactatgaatt |
23280032 |
T |
 |
| Q |
201 |
ctcctcctccctctaatcatgactttttggattcaaacaacacaccttttctt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
23280033 |
ctcctcctccctctaatcatgactttttggattcaagcaacacaccatttctt |
23280085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University