View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6248_low_4 (Length: 399)
Name: NF6248_low_4
Description: NF6248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6248_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 145 - 380
Target Start/End: Original strand, 9275215 - 9275450
Alignment:
| Q |
145 |
ttagagtgaaatgctggagaacaataatggtaaaacaattgagatcgtagggttaagagggatacatgttacagaagggaattgtgcttcaatttcaatt |
244 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9275215 |
ttagagtgaaatgatggagaacaataatggtaaaacaattgagatcatagggttaagagggatacatgttacagaagggaattgtgcttcaatttcaatt |
9275314 |
T |
|
| Q |
245 |
atgcaaactcaaattcacatgcatgctacatatcctctcatcccctacatattatttctttatgcaaactcaaattgcttttgnnnnnnncaaaatcatg |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9275315 |
atgcaaactcaaattcacatgcatgctacatatcctctcatcccctacatattatttctttatgcaaactcaaattgcttttgtttttttcaaaatcatg |
9275414 |
T |
|
| Q |
345 |
attctggtgaggatggtttttaaaacacgataaaac |
380 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9275415 |
attctggtgaagatggtttttaaaacacgataaaac |
9275450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 12 - 86
Target Start/End: Original strand, 9275082 - 9275156
Alignment:
| Q |
12 |
catcatcaaacaagtttatttgcaaacaaaatgcagcataccagcaaatacctttgacacagtaaacactccatt |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9275082 |
catcatcaaacaagtttatttgcaaacaaaatgcagcataccagcaaatacctttgacacagtaaacactccatt |
9275156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 14 - 81
Target Start/End: Original strand, 9278463 - 9278529
Alignment:
| Q |
14 |
tcatcaaacaagtttatttgcaaacaaaatgcagcataccagcaaatacctttgacacagtaaacact |
81 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||| ||||||| ||||||||| || ||||||||||| |
|
|
| T |
9278463 |
tcatcaaacaagtttatttgcgaacaaaaagcagcttaccagcgaataccttt-acccagtaaacact |
9278529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 145 - 209
Target Start/End: Original strand, 9278593 - 9278657
Alignment:
| Q |
145 |
ttagagtgaaatgctggagaacaataatggtaaaacaattgagatcgtagggttaagagggatac |
209 |
Q |
| |
|
|||| |||||||| ||||||| ||||||||||||||||||||||| ||||||| |||| ||||| |
|
|
| T |
9278593 |
ttagggtgaaatgagggagaacgataatggtaaaacaattgagatcatagggtttagagagatac |
9278657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University