View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6248_low_8 (Length: 385)
Name: NF6248_low_8
Description: NF6248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6248_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 4e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 20 - 207
Target Start/End: Complemental strand, 8467728 - 8467541
Alignment:
| Q |
20 |
gagaggaatggctcaagcccttacgctatagcgaaatacatggaagagaagttcaagccggtgcttccaacgaatttcaagaagatactaagcttgcagc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
8467728 |
gagaggaatggctcaagcccttacgctatagcgaaatacatggacgagaagttcaagccggtgctcccagcaaatttcaagaagatactaagcttgcagc |
8467629 |
T |
|
| Q |
120 |
ttaagaatcaaacaatgagagggaagctggtgaagatcaaagcttcgtataaactatctgatgccgagaagccgaaaaaggagaaaaa |
207 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8467628 |
ttaagaatcaaaccaagagagggaagctggtgaagatcaaagcttcgtataaactatctgatgccgagaagccgaagaaggagaaaaa |
8467541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University