View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6253_high_11 (Length: 245)
Name: NF6253_high_11
Description: NF6253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6253_high_11 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 22801475 - 22801707
Alignment:
| Q |
13 |
aatatcatttcattatcttgcttttggtatgaacattcccttaattggggaatgacaaaattgtttgtaaagacggcgctcacactttgatgaagtgggt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22801475 |
aatatcatttcattatcttgcttttggtatgaacattcccttaattggggaatgacaaaattgtttgtaaagacggcgctcacactttgatgaagtgggt |
22801574 |
T |
|
| Q |
113 |
attgtcacttcaacggtgcaggtggaagcacaatccttcactttttcctaattccctataatggatgcttgatccttaagatcaccacttgtaagctctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22801575 |
attgtcacttcaacggtgcaggtggaagcacaatccttcactttttcctaattccctataatggatgcttgatccttaagatcaccacttgtaagctctg |
22801674 |
T |
|
| Q |
213 |
ttgcaccagcacttctgattgaaggcgtgtccc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22801675 |
ttgcaccagcacttctgattgaaggcgtgtccc |
22801707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 22868350 - 22868534
Alignment:
| Q |
13 |
aatatcatttcattatcttgcttttggtatgaacattcccttaattggggaatgacaaaattgtttgtaaagacggc--gctcacactttgatgaagtgg |
110 |
Q |
| |
|
|||||||||| | | |||||||||||||||||||||| ||||||||||||||| | ||||||||||| |||||| || | ||||||||| |||||| || |
|
|
| T |
22868350 |
aatatcattttaatctcttgcttttggtatgaacatttccttaattggggaataagaaaattgtttggaaagacagcttgatcacactttcatgaagagg |
22868449 |
T |
|
| Q |
111 |
gtattgtcacttcaacggtgca-ggtggaagcacaatccttcactttttcctaattccctataatggatgcttgatccttaagat |
194 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||| || ||||| |||| |
|
|
| T |
22868450 |
gtattgtcacttcaacggtgcacgatggaagcacaatccttcactttttccttattccctataatggatgcgtggtcctttagat |
22868534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University