View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6253_high_12 (Length: 238)
Name: NF6253_high_12
Description: NF6253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6253_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 22801788 - 22802009
Alignment:
| Q |
1 |
tttgatcggtgttgacgtgtccgtgttagtgtcgtttccggtgtctgtgtccatgcttcatagcttgtaaggaattacaactccattctccaccatgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22801788 |
tttgatcggtgttgacgtgtccgtgttagtgtcgtttccggtgtctgtgtccatgcttcatagcttgtaaggaattacaactccattctccaccatgcag |
22801887 |
T |
|
| Q |
101 |
gtatgttatgggatttcagttttgtgcacctaatgatacttccctcaaatctattgcttacaccaattatgaccatgatattgagacccattgtcatatt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22801888 |
gtatgttatgggctttcagttttgtgcacctaatgatacttccctcaaatctattgcttacaccaattatgaccatgatattgagacccattgtcatatt |
22801987 |
T |
|
| Q |
201 |
gctgcccaacttctctgttttt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
22801988 |
gctgcccaacttctctgttttt |
22802009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 11594263 - 11594302
Alignment:
| Q |
24 |
tgttagtgtcgtttccggtgtctgtgtccatgcttcatag |
63 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
11594263 |
tgttagtgtcgtattcggtgtctgtgtccatgcttcatag |
11594302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 66
Target Start/End: Complemental strand, 6389727 - 6389690
Alignment:
| Q |
29 |
gtgtcgtttccggtgtctgtgtccatgcttcatagctt |
66 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
6389727 |
gtgtcgtgtccggtgtctgtgtccgtgcttcatagctt |
6389690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University