View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6253_low_8 (Length: 348)
Name: NF6253_low_8
Description: NF6253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6253_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 7e-80; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 193 - 343
Target Start/End: Complemental strand, 676598 - 676448
Alignment:
| Q |
193 |
tttagggtaagattaaagaagaaagataatttgttactcaaagaaagaatagatcagaaaaaagccactaaagaatgtcaagagcaatatgtaggacatg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
676598 |
tttagggtaagattaaagaagaaagataatttgttactcaaagaaagaatagatcagaaaaaagccactaaagaatgtcaagagcaatatgtaggacatg |
676499 |
T |
|
| Q |
293 |
ttatagtagtacatatacaaatagggctttcatcaaaatttgttacctttg |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
676498 |
ttatagtagtacatatacaaatagggctttcatcaaaatttgttacctttg |
676448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 676832 - 676771
Alignment:
| Q |
18 |
atctcaagcacatttaaaa-tgattttagcctaagtaacttctattgaactcaaggacttta |
78 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
676832 |
atctcaagcacatttaaaaatgattttagcctaagtaacttctattgaactcaaggatttta |
676771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 75 - 119
Target Start/End: Complemental strand, 676649 - 676605
Alignment:
| Q |
75 |
tttatttacatactaagattttgtccatcacaaaaacaaatcaac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
676649 |
tttatttacatactaagattttgtccatcacaaaaacaaatcaac |
676605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University