View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6254_high_11 (Length: 311)
Name: NF6254_high_11
Description: NF6254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6254_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 17 - 303
Target Start/End: Original strand, 47002841 - 47003127
Alignment:
| Q |
17 |
atcacaggtttctccaacctacaaagaattgccattggacttttgttgtcgacaatcggaatggcagctgcttctctgattgaagtgaaacggttgtcag |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47002841 |
atcacaggtttctccaacctacaaaggattgccattggacttttgttgtcgacaatcggaatggcagctgcttctctgattgaagtgaaacggttgtcag |
47002940 |
T |
 |
| Q |
117 |
tggcaaaaggtgtaaaaggcaaccaaacaacactaccaattagtgttttccttctagtcccacaattcttcttggttggttctggtgaagcattcatata |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47002941 |
tggcaaaaggtgtaaaaggcaaccaaacaacactaccaattagtgttttccttctagtcccgcaattcttcttggttggttctggtgaagcattcatata |
47003040 |
T |
 |
| Q |
217 |
cacaggacaacttgatttcttcataacacaatcaccaaaaggaatgaaaacaatgagcactggtctcttcctaacaactttatccct |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47003041 |
cacaggacaacttgatttcttcataacacaatcaccaaaaggaatgaaaacaatgagcactggtctcttcctaacaactttatccct |
47003127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University