View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6254_low_23 (Length: 231)
Name: NF6254_low_23
Description: NF6254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6254_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 213
Target Start/End: Complemental strand, 38557239 - 38557041
Alignment:
| Q |
15 |
aaatccaatgctcacaattccagcgccaaacatagagaagatctactatccacaatttcacagaaccatgaccatatgcaccaagccaaacatagactag |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38557239 |
aaatccaatgctcacaactccagcgccaaacatagagaagatctactatccacaatttcacagaaccatgaccatatgcaccaagccaaacatagactag |
38557140 |
T |
|
| Q |
115 |
acatgtcaaaatcattataacatcaatcccaccacagtcttgccgatacacagacctcgcaaccaggtctcttatcataacaaaatgcactctgctcct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38557139 |
acatgtcaaaatcattataacatcaatcccaccacagtcttgccgatacacagacctcgcaaccaggtctcttatcataacaaaatgcactctgctcct |
38557041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University