View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6255_low_1 (Length: 450)
Name: NF6255_low_1
Description: NF6255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6255_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 422; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 422; E-Value: 0
Query Start/End: Original strand, 4 - 437
Target Start/End: Complemental strand, 36011039 - 36010606
Alignment:
| Q |
4 |
tggtcaccgcagattcatatctccggcagcgccggcgatgaatcctccaagatgagtcgcagcgcttccgaatgggcgttccaacgctttttgcaagaag |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36011039 |
tggtcaccgcagattcatgtctccggcagcgccggcgatgaatcctccaagatgagtcgcagcgcttccgaatgggcgttccaacgctttttgcaagaag |
36010940 |
T |
 |
| Q |
104 |
ctgcctcaccttctccttcttcttcgtctgttgctgacaacaccggttttgccgatgctgcagcaaaagacggtgccgttttgcccaatggaccacctcc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36010939 |
ctgcctcaccttctccttcttcttcgtctgttgctgataacaccggttttgccgatgctgcagcaaaagacggtgccgttttgcccaatggaccacctcc |
36010840 |
T |
 |
| Q |
204 |
ggtggccgtggattccgatgaatatcgggcttttctgaagagtaagctgaatctcgcgtgtgctgccgttgccatgaccagggtatttttgctttaaccc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36010839 |
ggtggccgtggattccgatgaatatcgggcttttctgaagagtaagctgaatctcgcctgtgctgccgttgccatgaccagggtatttttgctttaaccc |
36010740 |
T |
 |
| Q |
304 |
cctttttgttattacaatgtgaaatcattccaatcattttgatttgtatttgtatctgttttgttcatgtatttggtatattggtgttgtgaaaaattca |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36010739 |
cctttttgttattacaatgtgaaatcattccaatcattttgatttgtatttgtatctgttttgttcatgtatttggtatattggtgttgtgaaaaattca |
36010640 |
T |
 |
| Q |
404 |
attttttgttatttttgcatcatgggttatgata |
437 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36010639 |
attttttgttatttttgcatcatgggttatgata |
36010606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University