View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6257_low_5 (Length: 209)
Name: NF6257_low_5
Description: NF6257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6257_low_5 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 8405087 - 8404873
Alignment:
| Q |
1 |
cttcaatattttgaagaggaatggggtcaagattatgacataagcaaatatgtcaagggtaaactggacccc-acatgttaatgtttccg-atccagcac |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
8405087 |
cttcaatattttgaagaggaatggggtcaagattatgacataagcaaatatgtcaagggtaaactggacccccacatgttaatgtttccgtatccagcac |
8404988 |
T |
 |
| Q |
99 |
cttcttttctagttagtta----tttgtataaatatatacatatactaaaatcttcaatcaaaaggctaaacacaaaatatttgcaacatgcattcatca |
194 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8404987 |
cttcttttctagttagttaattatttgtataaatatatacatatactaaaatcttcaatcaaaaggctaaacacaaaatatttgcaacatgcattcatta |
8404888 |
T |
 |
| Q |
195 |
caatcttcatcacca |
209 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
8404887 |
aaattttcatcacca |
8404873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University