View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6259_high_14 (Length: 251)
Name: NF6259_high_14
Description: NF6259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6259_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 9652568 - 9652331
Alignment:
| Q |
1 |
atcattccaggaatctttgggtgccagtgcaattctgtagggtatttttgtccctgtttcaagttaaaagaaataagaggataagccgaaaacaatttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9652568 |
atcattccaggaatctttgggtgccagtgcaattctttagggtatttttgtccctgtttcaagttaaaagaaataagaggataagccgaaaacaatttat |
9652469 |
T |
|
| Q |
101 |
agacacggcaaactattttcaaaacttctttcaatttcaaaaacttacactagcgtttatgtcataagataagttcaaattacctggtgaataaataata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9652468 |
agacacggcaaactattttcaaaacttctttcaatttcaaaaacttacactagtgtttatgtcataagataagttcaaattacctggtgaataaataata |
9652369 |
T |
|
| Q |
201 |
gttggggaggcagatcttcaggagcccttatttgtcct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9652368 |
gttggggaggcagatcttcaggagcccttacttgtcct |
9652331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 34734983 - 34735034
Alignment:
| Q |
174 |
ttcaaattacctggtgaataaataatagttggggaggcagatcttcaggagc |
225 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34734983 |
ttcaaattacctggtgaataaacaatagttggggaggcagatcttcaggagc |
34735034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 34734608 - 34734687
Alignment:
| Q |
1 |
atcattccaggaatctttgggtgccagtgcaattctgtagggtatttttgtccctgtttcaagttaaaagaaataagagg |
80 |
Q |
| |
|
|||||||||||||||| || |||||| |||| |||| | |||| |||||||||||||| |||||| || ||||||||||| |
|
|
| T |
34734608 |
atcattccaggaatctgtgtgtgccaatgcagttctttggggtctttttgtccctgttgcaagttcaaggaaataagagg |
34734687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University