View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6259_high_15 (Length: 247)
Name: NF6259_high_15
Description: NF6259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6259_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 108 - 240
Target Start/End: Complemental strand, 46892030 - 46891899
Alignment:
| Q |
108 |
tgaggctggagtgtgaggagggttccatgtgaaatttagaatgtttggatggtagactagccaatgttcaaggattctgccaatggggttttccattaac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46892030 |
tgaggctggagtgtgaggagggttccatgtgaaatttagaatgtttggatggtagactagccaatgttcaaggattctgccaatggggttttccattcac |
46891931 |
T |
 |
| Q |
208 |
ctcttttttgggtttgggggagaggtgcctttg |
240 |
Q |
| |
|
||| ||||||||||||||||||| ||||||||| |
|
|
| T |
46891930 |
ctc-tttttgggtttgggggagaagtgcctttg |
46891899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University