View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6259_high_15 (Length: 247)

Name: NF6259_high_15
Description: NF6259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6259_high_15
NF6259_high_15
[»] chr7 (1 HSPs)
chr7 (108-240)||(46891899-46892030)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 108 - 240
Target Start/End: Complemental strand, 46892030 - 46891899
Alignment:
108 tgaggctggagtgtgaggagggttccatgtgaaatttagaatgtttggatggtagactagccaatgttcaaggattctgccaatggggttttccattaac 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
46892030 tgaggctggagtgtgaggagggttccatgtgaaatttagaatgtttggatggtagactagccaatgttcaaggattctgccaatggggttttccattcac 46891931  T
208 ctcttttttgggtttgggggagaggtgcctttg 240  Q
    ||| ||||||||||||||||||| |||||||||    
46891930 ctc-tttttgggtttgggggagaagtgcctttg 46891899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University