View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6259_high_16 (Length: 243)
Name: NF6259_high_16
Description: NF6259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6259_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 14435523 - 14435739
Alignment:
| Q |
19 |
gatccatgcaacaattcctccagactgtgttgatcgtttccagaatacttttcacgagaaccgtgtttacttgatctctaatttcaaggttttaccaaat |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
14435523 |
gatccaagcaacaattcctccagactgtgttgatcgtttccagaatacttttcatgagaaccgtgtttacatgttctctaatttcaaggttttaccaaat |
14435622 |
T |
 |
| Q |
119 |
gatcgttctacgagggtcacttcccataatcataggctgaaactcttggaggagactgtggttgtcaatgatgatggttatatcatccaaaggtttggtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14435623 |
gatcgttctacgagggtcacttcccataatcataggctgaaactctgggaggagactgtggttgtcaatcatgatggttatatcatccaaaggtttggtt |
14435722 |
T |
 |
| Q |
219 |
tgtccttcttttcatct |
235 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
14435723 |
tctccttcttttcatct |
14435739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University