View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6259_high_22 (Length: 229)

Name: NF6259_high_22
Description: NF6259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6259_high_22
NF6259_high_22
[»] chr7 (1 HSPs)
chr7 (17-210)||(46892426-46892619)


Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 46892426 - 46892619
Alignment:
17 ttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccaccgttggtatccgaccgcct 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
46892426 ttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccaccgttggaatccgaccgcct 46892525  T
117 tggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtctcatgctttattatcacttcggatccgatg 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46892526 tggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtctcatgctttattatcacttcggatccgatg 46892619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University