View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6259_high_3 (Length: 598)
Name: NF6259_high_3
Description: NF6259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6259_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 3e-74; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 294 - 439
Target Start/End: Complemental strand, 213887 - 213742
Alignment:
| Q |
294 |
gagttcctgttgatcctcttgagtggcaaatttctcaagatacagctaatactattgttgcttctttcgctaatactgtcggtgccgctgaatctgtttt |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
213887 |
gagttcctgttgatcctcttgagtggcaaatttctcaagatacagctaatactattgttgcttctttcgccaatactgtcggtgccgctgaatctgtttt |
213788 |
T |
 |
| Q |
394 |
gagggttgctgctactggtcatgacaagagactcttttttaaggtt |
439 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
213787 |
gagggttgctgctactggtcatgacaagagactcttttttaaggtt |
213742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 478 - 590
Target Start/End: Complemental strand, 213706 - 213599
Alignment:
| Q |
478 |
acttcaaactcatctaccaatcattacattacattacattacaggtcattctttgcctttatgcattatctgctcttggaagactggctttgggtattac |
577 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
213706 |
acttcaaactcatctaccaatcattacattacattaca-----ggtcattctttgcctttatgcattatctgctcttggaagactggctttgggtattac |
213612 |
T |
 |
| Q |
578 |
tatcgcctatgct |
590 |
Q |
| |
|
||||||||||||| |
|
|
| T |
213611 |
tatcgcctatgct |
213599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 49 - 116
Target Start/End: Complemental strand, 214137 - 214070
Alignment:
| Q |
49 |
tgaaattgggaaagtgattattgcgttggtatgcggcacacttgtttactatcattgcgctttcaaga |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
214137 |
tgaaattgggaaagcgattattgcgttggtatgcggcacacttgtttactatcattgcgctttcaaga |
214070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University