View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6259_low_24 (Length: 230)
Name: NF6259_low_24
Description: NF6259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6259_low_24 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 61 - 230
Target Start/End: Complemental strand, 41331928 - 41331759
Alignment:
| Q |
61 |
ctccttaatgtgtggttctcttccctagtcacccacttacattcatggatagatatcaatcaagcatgtacctttgaagtttatagtggttcactatctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41331928 |
ctccttaatgtgtggttctcttccctagtcacccacttacattcatggatagatatcaatcaagcatgtacctttgaagtttatagtggttcactatctg |
41331829 |
T |
 |
| Q |
161 |
ttctattttaagctctagtagagaataaagatagtggtatgggcatactatattgtatagtgcattaatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41331828 |
ttctattttaagctctagtagagaataaagatagtggtatgggcatactatattgtatagtgcattaatt |
41331759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University