View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6260_high_6 (Length: 306)
Name: NF6260_high_6
Description: NF6260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6260_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 19 - 173
Target Start/End: Complemental strand, 29029836 - 29029682
Alignment:
| Q |
19 |
accacaatgtcagaaaataaacgctctcatgaagagtctctcaaagagaatgaggtgaccaagaaagataatgaaattggtaagcattttttcttccttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
29029836 |
accacaatgtcagaaaataaacgctctcatgaagagtctctcaaagagaatgaggtgaccaagaaagagaatgaaattggtaacctttttttcttccttc |
29029737 |
T |
 |
| Q |
119 |
ttaatcttatctcaataatgtaattgttgcttcttgtattttcttatgcactccc |
173 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29029736 |
ttaatcttatctcaataatataattgttgcttcttgtattttcttatgcactccc |
29029682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 21 - 86
Target Start/End: Complemental strand, 36070704 - 36070639
Alignment:
| Q |
21 |
cacaatgtcagaaaataaacgctctcatgaagagtctctcaaagagaatgaggtgaccaagaaaga |
86 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36070704 |
cacaatgtcaggaaatatgtcctctcatgaagagtctctcaaagagaatgaggagaccaagaaaga |
36070639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 165
Target Start/End: Complemental strand, 36070609 - 36070536
Alignment:
| Q |
89 |
atgaaattggtaagcattttttcttccttcttaatcttatctcaataatgtaattgttgcttcttgtattttcttat |
165 |
Q |
| |
|
||||| |||||||| |||||||||| |||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
36070609 |
atgaagttggtaagtgttttttcttctttcttaatcttatctcaataatgtg---gctgcttcttgtattttcttat |
36070536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 65
Target Start/End: Original strand, 27588931 - 27588975
Alignment:
| Q |
21 |
cacaatgtcagaaaataaacgctctcatgaagagtctctcaaaga |
65 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||||||||||| |
|
|
| T |
27588931 |
cacaatgtcagaaaataagcgtgctcatgaagtgtctctcaaaga |
27588975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University