View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6260_low_10 (Length: 242)
Name: NF6260_low_10
Description: NF6260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6260_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 5545590 - 5545779
Alignment:
| Q |
18 |
aacattagtcacattaagattagtttgatcttttatgttaagtctcgagtaaatcgtatacaaaatatggcatgtctaatgaaagtgaacacgtacataa |
117 |
Q |
| |
|
||||||||||||| || ||||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5545590 |
aacattagtcacactaggattagtttgatcctttatgttaagtctcgagtaaatcgtgtacaaaatatagcatgtctaatgaaagtgaacacgtacataa |
5545689 |
T |
 |
| Q |
118 |
atacttaattttatatttgatcacctacataatatattttaagcttcactctagtcgctaaattataaaagttttaatttgaccccttct |
207 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||| |||||||| |
|
|
| T |
5545690 |
atacttaatttcatatttgatctcctacataatatattttaagcttcactttagttgctaaattttaaaagttttaatttggccccttct |
5545779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University