View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6260_low_5 (Length: 316)
Name: NF6260_low_5
Description: NF6260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6260_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 20 - 293
Target Start/End: Original strand, 45438985 - 45439258
Alignment:
| Q |
20 |
atccaatgttaatactacaaaatcaagcatctgaatctttatgcaatgaaataaagcctgacacaaatttaggccctgatggtttaggggacatattgcc |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45438985 |
atccaatgttaatgctacaaaatcaagcatctgaatctttatgcaatgaaataaagcctgacacaaatttaggccctgatggtttaggggacatattgcc |
45439084 |
T |
 |
| Q |
120 |
acattccaagcaacaagaatcttctcaatcttataatatagcagcttttggacaagtgtagcaggcttttgacataaagaatgattttaacgggcttcaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45439085 |
acattccaagcaacaagaatcttctcaatcttataatatagcagcttttggacaagtgtagcaggcttttgacataaagaatgattttaaggggcttcaa |
45439184 |
T |
 |
| Q |
220 |
ggaatttcagattgtgtgaccaaatattttgtttttgtatatagtttttcaccaaacatttatgtcagtctctt |
293 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45439185 |
ggaatttcagattgtgcgaccaaatattttgtttctgtatatagtttttcaccaaacatttatgtcagtctctt |
45439258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University