View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6260_low_8 (Length: 263)
Name: NF6260_low_8
Description: NF6260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6260_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 39 - 245
Target Start/End: Original strand, 5185733 - 5185932
Alignment:
| Q |
39 |
aacggaaacatttgcatgtacatagttgtcgatagcgggtgaaaacatctccacctccacccccaccaaactagtgaatgggctatttgacgggnnnnnn |
138 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5185733 |
aacgggaacatttgcaggtacatagttgtcgacagcggatgaaaaca------cctccacccccaccaaactagtgaatgggctatttgacgg-aaaaaa |
5185825 |
T |
 |
| Q |
139 |
nntctccacccatttttggtcttcacacattgtttactatcaaaatcaacatggttgattattttnnnnnnnnttgtatatataactgataatcaccgga |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5185826 |
aatctccacccatttttggtcttcacacattgtttactatcaaaatcaacatggttgattattttaaaaaaaattgtatatataactgataatcaccgga |
5185925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University